Hexokinase 2-specific inhibitor in acute central nervous system injury disease

a central nervous system injury and hexokinase inhibitor technology, applied in the field of biomedicine, can solve the problems that both hexokinase 1- and 3-interferences cannot inhibit the activation of hypoxia-induced microglia

Active Publication Date: 2020-12-17
GUANGZHOU CELLPROTEK PHARMA
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present inventors discovered that a specific inhibitor of hexokinase 2 has a protective effect on the central nervous system in the prevention and treatment of injury. They found that this inhibitor reduced inflammation and damage to nerve cells caused by hypoxia and is prohibited in humans through gene knockdown. This discovery has led to the development of a new therapy for central brain damage.

Problems solved by technology

Moreover, the inventors also found that both hexokinase 1- and 3-interferences cannot inhibit the activation of hypoxia-induced microglia.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hexokinase 2-specific inhibitor in acute central nervous system injury disease
  • Hexokinase 2-specific inhibitor in acute central nervous system injury disease
  • Hexokinase 2-specific inhibitor in acute central nervous system injury disease

Examples

Experimental program
Comparison scheme
Effect test

example 1

Enhanced Glycolytic Flux is Essential for Hypoxia-Induced Microglial Activation

[0030]Materials

[0031]Mouse BV2 microglia cells, Dulbecco's modified Eagle's medium (DMEM, Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), 2-deoxy-D-glucose (Sigma-Aldrich, D8375), 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG, Thermo Fisher Scientific, N13195), Annexin / PI detection kit (Biotool, B32115), flow cytometer (CytoFLEX S), laser scanning confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy Laboratory Products).

[0032]Antibodies used in Western blot and immunofluorescence:

[0033]CD 11b antibody (Novus biologicals, NB 110-89474);

[0034]TNF-α antibody (CST, 11498);

[0035]IL-1β antibody (CST, 12507);

[0036]IL-6 antibody (Bioss, bs-6309R);

[0037]α-Tubulin antibody (Bioworld, AP0064).

[0038]Methods

[0039]a) Cell culture: BV2 cells were grown in DMEM containing 10% fetal bovine serum (FBS), placed in 5% CO2, cultured in a 37° C. constant temperat...

example 2

Upregulation of Hexokinase Family Members was Involved in the Microglial Activation After Hypoxia Exposure

[0048]Materials

[0049]Mouse BV2 microglia cell line, primary cultured mouse microglia, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), RNA extraction reagent TRIzol (Thermo Fisher Scientific, 15596-018), RNA quantification kit (Thermo Fisher Scientific, Q10211), SuperReal qPCR PreMix (SYBR Green) (Tiangen, FP202-01), real-time PCR system (Applied Biosystems), anoxic chamber (Coy Laboratory Products)

[0050]Antibodies used in Western blotting:

[0051]Hexokinase 1 antibody (Abcam,150423),

[0052]Hexokinase 2 antibody (CST, 2867s),

[0053]Hexokinase 3 antibody (Santa Cruz, sc-28890),

[0054]α-Tubulin antibody (Bioworld, AP0064).

[0055]The following mouse gene primer sequences were used in real-time PCR.

PrimersForwardReverseHK1GTAGGGGTACGCTTAGGTGGACCCAGGAGTCCATAAAGCCHK2GAGAAAGCTCAGCATCGTGGTCCATTTGTACTCCGTGGCTHK3GCTCCGTTGAGAGCAGATTTTTGCTGCAAGCATTCCAGTTPFKMGTTT...

example 3

Hexokinase 2, Instead of Other Hexokinase Family Members, Mediated Hypoxia-Induced Activation of Microglia

[0062](1) Hexokinase 2 Interference Could Effectively Inhibit the Hypoxia-Induced Activation Process of Microglia

[0063]Materials

[0064]Mouse BV2 microglia cell line, primary cultured mouse microglia, high glucose DMEM medium (Gibco, 11965-118), fetal bovine serum (Gibco, 10099-141), siRNA fragments, siRNA transfection reagent (Lipofectamine RNAiMAX Reagent, Thermo Fisher Scientific, 13778-500), inverted phase contrast microscope (Nikon ECLIPSE Ti Microscope), laser confocal microscope (Nikon A1 Spectral Confocal Microscope), anoxic chamber (Coy Laboratory Products).

[0065]Antibodies used in Western blotting:

[0066]Hexokinase 1 antibody (Abcam,150423),

[0067]Hexokinase 2 antibody (CST, 2867s),

[0068]Hexokinase 3 antibody (Santa Cruz, sc-28890),

[0069]CD 11b antibody (Novus biologicals, NB 110-89474),

[0070]α-Tubulin antibody (Bioworld, AP0064).

[0071]Methods

[0072]a) Cell culture: BV2 cel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
timeaaaaaaaaaa
thicknessaaaaaaaaaa
Phase contrast imagesaaaaaaaaaa
Login to View More

Abstract

Provided are applications of a hexokinase 2-specific inhibitor in preparing a medicament for preventing and treating acute central nervous system injury.

Description

FIELD OF INVENTION[0001]The present disclosure is in the field of biomedicine and relates to the uses of hexokinase 2-specific inhibitors in the prophylaxis and treatment of acute central nervous system (CNS) injury diseases.BACKGROUND[0002]Stroke, either ischemic or hemorrhagic, is an acute cerebrovascular disease with brain damage caused by burst of blood vessels in the brain or diminished blood supply due to vascular occlusion. Ischemic stroke accounts for about 85% of the total cases. Tissue plasminogen activator (t-PA) is an FDA approved drug for ischemic stroke. However, t-PA is only suitable for 3-6 hours after stroke, and there is also a risk of cerebral hemorrhage and cerebral edema after treatment. These defects make t-PA application very limited and very few patients benefit. Therefore, safe and effective drugs that can be used for the prophylaxis and treatment of acute ischemic stroke are highly anticipated.[0003]The immune system-mediated inflammatory response following...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C07K16/40C12N15/113A61P25/00
CPCC07K16/40A61K45/06C12N15/1137A61P25/00A61K45/00A61K31/416A61K31/7004A61K31/19A61K31/506A61K31/7105A61K2300/00A61K2039/505
InventorYAN, GUANGMEIYIN, WEILI, YUANLU, BINGZHENGSHENG, LONGXIANG
OwnerGUANGZHOU CELLPROTEK PHARMA