Targeted small interference RNA formulation for treating viral Hepatitis B and its preparation

A hepatitis B, small interference technology, applied in antiviral agents, gene therapy, pharmaceutical formulations, etc., can solve problems such as low cationic load, achieve good protection, increase drug concentration, and inhibit virus replication and infection

Inactive Publication Date: 2007-10-24
广州拓谱基因技术有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage is that the cationic load is relatively small

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeted small interference RNA formulation for treating viral Hepatitis B and its preparation
  • Targeted small interference RNA formulation for treating viral Hepatitis B and its preparation
  • Targeted small interference RNA formulation for treating viral Hepatitis B and its preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Preparation of linear nucleic acid-binding polypeptides.

[0041] Synthesize single-stranded DNA sequences with overlapping ends of the following adjacent fragments,

[0042] 5'aagaaggccttattggcgttcgccttcgcc'3; 5'caccacctcgcgctcctcgcgctcctcgcgcaccacctcgc'3; 5'gctcgcgctccaccacctggcgctcgccctt'3 were dissolved in appropriate amount of water, ligated into double-stranded DNA molecules under the action of T4 DNA ligase, and cloned into the yeast expression vector pICZα, verified by enzyme digestion and sequenced After verification, the following procedure was used to introduce the expression vector into Pichia pastoris cells.

[0043] First, the DNA of the yeast expression vector pICZα was cut with Sac1 for more than 1 hour to linearize it. Make up water to 300ul, add 300ul phenol: chloroform: isoamyl alcohol (25:24:1) and mix by inversion. Centrifuge at 12000 rpm for 5 minutes. Take the supernatant, add 750ml ethanol, 30ul NaAc, -20°C, 30 minutes. Centrifuge,...

Embodiment 2

[0057] Example 2: Preparation of branched nucleic acid-binding polypeptides.

[0058] Branched peptide synthesis can be carried out on the ABI431A solid-phase automatic peptide synthesizer or manually synthesized. The sequence structure is shown in Figure 1. Adopt standard Fmoc method, select 0.125mmol Fmoc-MAP-Branch-PSC resin, make peptide chain extend from C terminal to N terminal one by one according to sequence, the dosage of each amino acid is 0.5mmol, amino acid: resin=4: 1, the first Amino acid was connected to the resin with DMAP, the activation of amino acid was coupled with HOBt and DCC, and the Fmoc protecting group was removed with 20% piperidine solution. After the polypeptide is synthesized, according to the steps recommended by PE company, add the compound after ice bath to the 10ml cutting solution under the condition of ice bath, use cutting solution B, its components are 0.75mg of crystalline phenol, 0.25ml of EDT, 0.5ml of sulfide anisole. Ionized water 0....

Embodiment 3

[0059] Example 3: Preparation of lactosylated or galactosylated nucleic acid-binding polypeptides.

[0060] Take 200 mg of the polypeptide prepared above, 800 mg of α-lactose, and 500 mg of sodium cyanoborate and dissolve them in 200 ml of water. After reacting at 37°C for 24 hours, adjust the reaction solution to pH 8.5 with 5mol / L KOH solution, and continue to react at 37°C for 6 hours. . The reaction solution was dialyzed with water at room temperature to terminate the reaction to remove unreacted lactose, and the sulfate-allthone method was used for qualitative detection until the lactose content in the dialysate was negative, and the product was vacuum-dried for later use.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
capacitanceaaaaaaaaaa
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

The invention discloses a targeted small interference RNA formulation for treating viral Hepatitis B and its preparation, wherein the preparation comprises small interfering RNAs, hepatocyte target molecules and nucleinic acid bonded molecules, and has the functions of leading the small interfering RNAs into hepatocyte or liver tissue, increasing medicinal concentration of liver, degrading genome RNA before HBV, thus achieving the purpose of regulating HBV gene and its expression.

Description

technical field [0001] The invention relates to a targeted small interfering RNA preparation for treating viral hepatitis B and a preparation method thereof. Background technique [0002] Hepatitis B virus (HBV) is one of the important pathogenic factors of viral hepatitis that seriously damages human health. Clinically, hepatitis B presents a variety of different disease types, including asymptomatic carrier state, acute and chronic hepatitis, severe hepatitis, liver cirrhosis, and may eventually develop into liver cancer. Interferon is currently the most commonly used anti-HBV drug, and the effective rate is only 30%-40% in patients with strictly selected indications. Nucleoside analogues have no obvious clinical effect and have obvious toxicity. [0003] In 1965, Blumberg and his colleagues discovered the Australian antigen (Austril-ianantigen). After a series of clinical observations, it was proved that the Australian antigen is the hepatitis B virus surface antigen (H...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K48/00A61P31/12A61P1/16
Inventor程度李宝健
Owner广州拓谱基因技术有限公司