Check patentability & draft patents in minutes with Patsnap Eureka AI!

SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use

A technology of gene expression and expression vector, which is applied in the field of siRNA, can solve the problem of large dosage, and achieve the effect of high specificity, high substrate specificity and small dosage

Inactive Publication Date: 2007-12-05
徐根兴
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Monoclonal or polyclonal antibodies to VEGF have been used to effectively inhibit neovascularization and tumor growth, and antisense oligonucleotides with high specificity and low side effects have been used to inhibit tumor growth. The gene therapy of oligonucleotide technology usually uses a large dose, which can only inhibit the expression of VEGF gene by 20-90%. The small double-stranded RNA (19-23bp) interference technology (RNAi) has obvious targeting effect and has amplified and sustained effect. The dose is small, and the mRNA expression of the target gene can be stably inhibited in vitro by more than 90%. If one base is changed, the inhibitory effect will disappear. Therefore, the interference with small double-stranded RNA will not affect the function of normal genes. Strong

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use
  • SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use
  • SiRAN and expression carrier for inhibiting human VEGF gene expression and their pharmaceutical use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The present invention is further illustrated by the following examples, but the scope of the present invention is not limited. Embodiment 1, machine synthesis small double-stranded interfering RNA (siRNA) suppresses the expression of VEGF gene in Hela cervical cancer cell

[0030] (1) Synthesize siRNA by machine

[0031] First look up the mRNA sequence of the VEGF gene (Xm166457) from GenBank, and start looking for the AA+N19+UU sequence or AA+N19 sequence from 75 bases after the start codon in the above gene sequence, where N19 has any 19 mRNA nucleotides sequence. Generally, a nucleotide sequence in which the G+C ratio of 21 nucleotides is about 50%, not higher than 70% or not lower than 30% is found. The 21 base sequences that meet the requirements are searched in the NCBI database for small nucleotide sequence homology core ESTLibrary through BLASU to ensure that the targeted target gene is unique.

[0032] Take sequence 3 (SEQ ID NO.3) as an example:

[0033] F...

Embodiment 2

[0040] Embodiment 2, by T 7 Small double-stranded interfering RNA (siRNA) synthesized by RNA polymerase inhibits the expression of VEGF gene in SMMC-7721 liver cancer cells

[0041] (1) Pass T 7 RNA polymerase synthesizes siRNA

[0042] The double-stranded RNA (siRNA) provided by the present invention is obtained according to the sequence of human VEGF mRNA found by the inventor in GenBank. These RNA sequences and their corresponding action sites of human VEGF mRNA are shown in Table 1 , taking sequence 1 (SEQ ID NO.1) as an example:

[0043] First design synthetic primers:

[0044] T 7 : 5'-TAA TAC GAC TCA CTA TAG-3' (SEQ ID NO.7)

[0045] sense: 5’-TCG TGA TGA TTC TGC CCT CCT CCT ATA GTG AGT CGT ATT A-3’

[0046] (SEQ ID NO.8)

[0047] Antisense: 5’-AAG GAG GAG GGC AGA ATC ATC ACT ATA GTG AGT CGT ATT A-3’

[0048] (SEQ ID NO.9)

[0049] Each of the three primers was dissolved in 100 μl.

[0050] (1) Form double-stranded DNA (dsDNA) first: take 1 nmol of T 7 Prim...

Embodiment 3

[0069] Example 3: The constructed hairpin double-stranded RNA inhibits the expression of VEGF gene in SMMC-7721 liver cancer cells

[0070] (1): Preparation of U6 promoter

[0071] 1. Design of U6 promoter PCR primers and PCR process

[0072] Primers:

[0073] 3' end primer

[0074] AATCTGCAGAAAAAGCGGACCGAAGTCCGCTCTAGATGCATGCTCGAGGTCGTCCGGTGTTTCGTCCTTTCCA

[0075] C

[0076] (SEQ ID NO.10)

[0077] 5' end primer

[0078] CGCGGATCCAAGGTCGGGCAGGAAGAGGGC

[0079] (SEQ ID NO.11)

[0080] PCR template: pTZU6+27

[0081] PCR process

[0082] 94°C for 1 minute, 57°C for 1 minute, 72°C for 1 minute, after 35 cycles, 72°C for 10 minutes, and store at 4°C.

[0083]2. The PCR product was subjected to 1% agarose gel electrophoresis. Under ultraviolet light, there was a very dark and bright band at 280bp. This is the band of the U6 promoter. Cut it off and recover the gel with Qiagen gel recovery kit For the double-stranded DNA above, take 17 μl of the recovered DNA, add 2 μl of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention publish a kind of siRNA and express carrier, which can control men's VEGF gene expression, and their application in preparing drug for affection relation to VEGF gene. The invention get a group VEGF orders by biocomputer technology and work out a group of siRNA to induce RNA disturbance basing on the RNA disturbance technology. After this, compose.

Description

technical field [0001] The invention relates to an siRNA, in particular to an siRNA and an expression carrier for inhibiting the expression of human VEGF gene and its application in pharmacy. Background technique [0002] Tumor growth and metastasis are closely related to blood vessels in the tumor area. Tumor blood vessels transport nutrients for the growth of tumor cells and excrete metabolic waste. The formation and development of tumor metastases also depend on the formation of tumor blood vessels. Therefore, cutting off the blood supply of tumor may achieve the purpose of inhibiting tumor growth and metastasis. Among the various growth factors that have been found to stimulate neovascularization, only VEGF specifically acts on vascular endothelial cells. VEGF is a growth factor isolated from tumor secretions for the first time in 1979. It acts efficiently and specifically on vascular endothelial cells and is a central regulator of neovascularization. It is not expresse...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/63C07H21/02A61K48/00A61P35/00
Inventor 樊燕蓉傅更锋刘文华肖祥华刘新卷郭丹徐根兴
Owner 徐根兴
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More