Yeast expression high specic activity phytase gene obtained using chemical synthesis and molecular evolution

A technology for synthesizing genes and yeast expression vectors, applied in plant gene improvement, biochemical equipment and methods, genetic engineering, etc., can solve the problems of low expression of original strains, easy degradation of mutagenized strains, and high production costs

Inactive Publication Date: 2008-07-02
STAR LAKE BIOSCI CO INC ZHAOQING GUANGDONG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the early stage of phytase development, the original strains were used for fermentation and production. However, the expression of the original strains was low and the production cost was high. Chemical mutagenesis or other mutagenesis methods can be used to obtain strains with improved enzyme production. However, mutagenesis is easy to cause The loss of other functions of the strain, in order to obtain a strain with high expression of the target gene and other functions are not affected, long-term observation and screening is required, which takes a long time, in addition, the mutagenized strain is easy to degenerate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast expression high specic activity phytase gene obtained using chemical synthesis and molecular evolution
  • Yeast expression high specic activity phytase gene obtained using chemical synthesis and molecular evolution
  • Yeast expression high specic activity phytase gene obtained using chemical synthesis and molecular evolution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: the chemical synthesis of acid phytase gene

[0027]1. The thermostable phytase gene was synthesized by continuous extension PCR. The length of the primer is 70-90bp, 20 oligonucleotide primers are synthesized, the primers are connected by 20-30bp overlapping sequences, and the Tm value is 60-66. Add all primers to the reaction system, the amount of primers in the middle is 10-20ng, and the amount of primers on both sides is 100-200ng. The PCR reaction system is 100 μL. The PCR amplification conditions were 94°C, 30s; 65°C, 30s; 72°C, 2min. A total of 35 cycles were performed.

[0028] Acid phytase gene synthesis primers:

[0029] phyi1:

[0030] TTGGCTGTCCCAGGCTTCCAGAAACCAGTCCTCTTGTGACACTGTTGATCAAGGTTATCAATGCTTCTCCGAG

[0031] phyi2:

[0032] GTTATCAATGCTTCTCCGAGACTTCTCACTTGTGGGGTCAATACGCTCCATTCTTTTCCTTGGCTAACGAATCCGTCATTCTCTCCAGAAG

[0033] Phyi3:

[0034] GAATCCGTCATTCTCTCCAGAAGTTCCAGCTGGTTGCAGAGTCACCTTCGCTCAGGTCTTGTCCAGACATGGTGCTAGATACCCAACTGA...

Embodiment 2

[0069] Embodiment 2: the DNA molecular rearrangement (DNA Shuffling) of acid phytase gene

[0070] 2.1PCR amplification of acid phytase gene and recovery

[0071] Using the synthetic phytase gene as a template, phyiZ1 and phyiF1 as primers to amplify the phytase gene, phyiZ1: (5'-TTGGATCCTTGGCTGTCCCAGCTTCCAGAAAC-3'); phyiF1: (5'-CGAG CTCTTAAGCGAAGCATTCAGCCCAGTCAC-3') The reaction conditions are: 94 Pre-denaturation at ℃ for 10min, denaturation at 94℃ for 30s, annealing and extension at 72℃ for 1.5min, a total of 30 cycles, 1% Agrose electrophoresis, and recovery of a 1.4kp gene fragment by the suction bag method.

[0072] 2.2 DNase I degrades DNA and recovers small fragments

[0073] Recover the phyi gene fragment with DNase I buffer (50mmol / L Tris-ClpH7.4+1mmol / L MgCl 2 ) in 100 μl; add 0.1U DNase I and treat at 25°C for 15 minutes. 70°C for 10 minutes. 10% acrylamide electrophoresis, recovery of small fragments of 10-50bp by suction bag method. The precipitate was disso...

Embodiment 4

[0082] Example 4: Yeast expression phytase vector construction

[0083] Design primers according to the sequences at both ends of the synthetic gene, add Xho I cutting point and signal state cutting sequence at the 5' end of the gene, the primer is: PHY1Z (5'-AACTCGAGAAAAGAGAACCTCCG GATTGGCTGTCCCAGGCTTCCAG AAACCAGTCC-3'), add Not I at the 3' end of the gene Cutting point: the primer is: PHY1F (5'-AACG CGGCCGCTTAAGCGAAGCATTCAGCCCAGTC ACCACCGGTAC-3'). After the amplified fragment was cloned, it was digested with Xho I and Not I, inserted into the pPIC9 vector (Invitrogen company product), and constructed into the yeast expression vector pPphyi of phyi ( figure 1 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

A phytase gene phyI with high specific activity suitable for yeast expression is prepared from synthetic gene through configuring mutant phytase gene library on prokaryotic expresstion plasmid, transferring to colibacillus, screening high-activity strains, and high-density fermenting.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering. Specifically, the acid phytase gene derived from Aspergillus niger is transformed by chemical synthesis method and in vitro recombination technology, so that it can be efficiently expressed in Pichia pastoris, and the expressed phytase is higher than that of The activity is improved and the structure is stable. Background technique [0002] Phytase widely exists in plants, animals and microorganisms. Phytases produced by different species have great differences in specific activity, optimum reaction pH, heat resistance and other properties. Many microorganisms can produce phytase with high specific activity. In 1968, Shien et al. investigated 2000 strains from 68 soil samples and found that 21 of all 22 black mold strains could produce phytase. The first isolated and purified phytase is from Aspergillus terreus NO.9A-1, its optimal pH is 4.5, the optimal reaction temperature is 70°...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/16C12N15/81C12N1/19C12N15/55
Inventor姚泉洪彭日荷熊爱生
OwnerSTAR LAKE BIOSCI CO INC ZHAOQING GUANGDONG