Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease
A phytochrome, plant disease technology, applied in the field of target application, gene encoding phytochrome protein, can solve problems such as aggravating environmental pollution, drug residues, and increasing agricultural costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1 Construction of Xanthomonas mutant library of cabbage black rot
[0025] Tn5gusA5 (Sharma, 1991) was introduced into Xcc wild-type strain 8004 using the shuttle plasmid pLAFR1 between E. Xcc::Tn5gusA5 insertion mutants were screened with resistance markers of Xcc, combined with the whole genome sequence of Xcc (genome sequence number NC_007086) and TAIL-PCR (Thermal Asymetric Interlaced-PCR) technology (Yao-Guang Liu, 1995), it was determined that Tn5gusA5 was in The insertion position on the genome, and PCR verification was performed on the insertion position. By investigating the phenotypic changes such as pathogenicity, extracellular enzyme activity, and extracellular polysaccharide synthesis of mutants, the pathogenicity-related genes are screened (Tang et al, 2005). The present invention relates to one of the new pathogenicity-related genes -- XC4241 gene (phytochrome-like protein gene), its insertion mutant number is 064H01, and the screening process...
Embodiment 2
[0026] Example 2 Cloning and sequence determination of XC4241 gene (phytochrome-like protein gene)
[0027] According to the gene sequence of XC4241 (see sequence listing, base 1 to base 2305), design primers (upstream primer GGGAATTC CGATGCCGCCGTGCCGCCGCCG and downstream primer GGTCTAGA GTCATGCCGATCCCGAGCACCG; PCR conditions 95°C for 3min; 95°C for 30sec, 60°C for 30sec, 72°C 2.5min, 30 cycles; 72°C for 5min), using the total DNA of Xanthomonas cabbage black rot strain 8004 as a template, amplify the full-length sequence of the gene by PCR, and clone it into the cloning vector pGEM3Zf(+) In this method, the DNA nucleotide sequence (SEQ ID No.1) was determined on an ABI377 DNA automatic sequencer by the dideoxynucleotide method. The correct XC4241 gene sequence verified by sequencing was cloned into the shuttle vector pLAFRJ, and the recombinant plasmid pCXC4241 containing the gene was obtained. The plasmid was digested with EcoRI and XbaI, and besides a 22kb vector band, the...
Embodiment 3
[0028] Example 3 Verification of XC4241 Gene Insertion Mutant 064H01
[0029] The insertion mutant 064H01 was sequenced and located by TAIL-PCR, and it was found that it was inserted into the XC4241 gene. Using a primer on the IS50R side of the transposon Tn5
[0030] (CCGCCGAAGAGAACACAGATTTA) and a primer for the upstream gene XC4242 (GenBank accession number YP_245300)
[0031] (5'-CCACATCGACGCCGATACCTACG-3') paired for PCR verification (95°C 3min; 95°C 30sec, 60°C 30sec, 72°C 45sec, 30 cycles; 72°C 5min), the expected size of the product is 676 bp (see figure 2 ).
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 