Method for detecting ura DNA glycosidase activity adopting molecular beacon as substrate

A molecular beacon and uracil technology, applied in the field of protein qualitative and quantitative detection, can solve the problems of cumbersome operation process and low sensitivity, and achieve the effect of reducing damage, saving experimental time, and safe UDG activity detection

Inactive Publication Date: 2007-08-01
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the product of this method also needs electrophoresis analysis and identification, so the whole operation process is very loaded down with trivial details, and the sensitivity of the above-mentioned method is all very low
At present, there is no public literature report on the detection of uracil DNA glycosidase activity by fluorescence method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting ura DNA glycosidase activity adopting molecular beacon as substrate
  • Method for detecting ura DNA glycosidase activity adopting molecular beacon as substrate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1 pure UDG activity detection

[0027] 1. Design and synthesis of molecular beacons:

[0028] Refer to the oligonucleotide substrates used to detect UDG activity in the past, and then determine the primary sequence of the molecular beacon according to the principle of the lowest energy. DABCYL marker, and 7 pairs of sequences are complementary pairs to form a stem structure, such as 5'(7-FAM)-GACCTGC and GCAGGTC-(DABCYL)3'. The molecular beacon sequence is 5'(6-FAM)-GACCTGCUCAGTACGAGAGGACCGCAGGTC-3'

[0029] 2. Preparation of tested UDG samples:

[0030] Escherichia coli BL21(DE3) carrying the protein expression plasmid of Pdest17-UDG was grown at 37 degrees in LB medium containing 50ug / ul Kanade. When the OD600 value was 0.8, IPTG (isopropylthio-β-D-galactoside) was added to a concentration of 1Mm for induction. After 6 hours of induction, the cells were collected and lysed by adding lysate. The lysate was then centrifuged at 12,000 rpm for 45 minutes, ...

Embodiment 2

[0037] The detection of UDG activity in the crude extract of embodiment 2

[0038] 1. Design and synthesis of molecular beacons:

[0039] Same as Example 1, the substrate is still the above-mentioned molecular beacon.

[0040] 2. Construction of UDG mutant strain and preparation of crude extract:

[0041] a. Design of primers for UDG mutant strains:

[0042] First, design the primers for constructing mutant strains. In the primers, 20nt oligonucleotides are required to match the Pet28A plasmid template without the UDG coding sequence. In addition, 40nt oligonucleotide sequences are required to be compatible with the E.coli DY329 strain The adjacent sequence of the UDG coding gene is homologous. In summary, the primer sequences were designed as follows: Forward primer (5'-ttaagctagg cggattgaag attcgcagga gagcgag atg ggcagcagccatcatcatca tcatca -3') reverse primer (5'-agccgggtgg caactctgcc atccggcatttccccgcaa a tttggtatct gcgctctgct gaagcc ).

[0043] First, the sec-kan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for checking uracil DNA glycosidase activity taking molecule beacon as substrate. It makes use of UDG to cut the N- glycosidic bond between uracil (U) base and glycosyl in molecule beacon, then treats base- loss substrate with alkali to make product release fluorescent signal, and determines UDG activity according to fluorescent signal. The method comprises following steps: designing substrate molecule beacon, determining the first- class structure squence according to lowest free energy principle, inserting one deoxyuracil base into the molecule beacon stem of stem-loop structure, treating reacting mixing liquid with alkali of proper concentration after a certain time of thermal insulation, and separating stem-loop and emitting fluorescent. The fluorescent signal can be detected out on fluorescence detector directly without product separation. The invention can not only sensitivly detect pure UDG, but aslo can detect UDG content in coarse raffinate.

Description

technical field [0001] The invention relates to a method for detecting uracil DNA glycosidase activity using a molecular beacon as a substrate, which can sensitively detect the activity of pure uracil DNA glycosidase and the activity of uracil DNA glycosidase in a crude extract, and Its content can be quantitatively analyzed and belongs to the field of protein qualitative and quantitative detection. Background technique [0002] Uracil DNA Glycosylase (UDG) can cut the N-glycosidic bond between the wrongly inserted uracil (U) base and the sugar group in DNA, remove uracil, and leave an abasic site, This site can be recognized and repaired by other enzymes such as DNA polymerase and DNA ligase. Therefore, UDG can reduce the transversion rate from cytosine (C) and guanine (G) pairing to adenine (A) and thymine (T) pairing, prevent and repair mismatches in DNA, and reduce mutations in organisms One of the self-protection mechanisms. In addition, UDG is also a tool enzyme to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/34C12Q1/68
Inventor邹亚娟刘建华
OwnerSHANGHAI JIAO TONG UNIV