Seed specific highly effective promoter and its application
A promoter and specific technology, applied in the application, the use of vectors to introduce foreign genetic material, biochemical equipment and methods, etc., can solve the problems of toxicity, different expression levels, hindering the normal growth of plants, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1. Cloning of millet seed-specific promoter sequence pF128
[0035] Millet 3661 seeds (Institute of Variety Resources, Chinese Academy of Agricultural Sciences) were sterilized on the surface, placed in a petri dish covered with moist filter paper, and cultivated at 24-28°C for 3-5 days to make young leaves grow, and 2g of fresh and tender seedlings were collected. The total DNA was extracted with the improved method of CTAB, and 2-3 μl DNA samples were taken, and the purity and concentration were detected by agarose gel electrophoresis.
[0036] According to the known F128 cDNA sequence [Xue J. et al, Cloning and Characterization of seed-specific Expression f128 Gene in Setariaitalica. Journal of Agricultural Biotechnology, 2004, 12(5): 505-508.], design and synthesize 3 nested primers SP1-SP3, and according to the Tail-PCR method of Liu Yao-Guang et al., synthesize 4 degenerate primers AD1-AD4, the primer sequences are as follows:
[0037] Sp1: 5'-AATTAGGTCTT...
Embodiment 2
[0049] Example 2. Isolation of millet seed-specific promoter sequence pF128
[0050] The following two primers were designed and synthesized, and a restriction endonuclease HindIII site and a restriction endonuclease XbaI site were respectively added to the 5' ends of the two primers for the needs of separation and construction in the future:
[0051] Primer 1: 5'TGCTCTAGACCTCTCTTGGATGCTAACACA 3'
[0052] wxya
[0053] Primer 2: 5'CCAAGCTTTGTGGAGAAGCAGAGAGAAG 3'
[0054] Hind III
[0055] Using the plasmid DNA pMDpS3A2 as a template, carry out PCR reaction, the reaction system is as follows:
[0056]
[0057] Amplification conditions: 95°C for 10 min; 95°C for 1 min, 58.5°C for 1 min, 72°C for 1 min, a total of 30 cycles; 72°C for 10 min. The results of electrophoresis detection showed that (attached figure 2 Shown), amplified to obtain a 1053bp DNA fragment. Recover with DNA gel recovery kit (Tiangen Technology Biochemical Co., Ltd.), subc...
Embodiment 3
[0058] Example 3. Construction of plant expression vector pBIpF128
[0059] Build process such as image 3 As shown, the pMDpF128 plasmid was extracted by alkaline lysis method, and the pF128 promoter fragment was obtained by HindIII and XbaI double enzyme digestion, which was ligated with the large fragment of the plant expression vector pBI121 after the same enzyme digestion, and then the ligated product was transformed into CaCl 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( Cultivate overnight in LB liquid medium with a final concentration of 100 μg / ml, collect the bacteria by centrifugation and extract the plasmid pBIpF128 by alkaline lysis, and confirm that pBIpF128 contains the pF128 promoter after double digestion with restriction endonucleases HindIII and XbaI and PCR amplification fragment...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 