Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Coix lacryma-jobi gliadin alpha-coixin gene, its coding gene and application

A technology encoding protein and coixol, which can be applied in application, genetic engineering, plant genetic improvement, etc., and can solve problems such as unclear composition and structure

Inactive Publication Date: 2008-01-02
SHANGHAI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing data have shown that the 22kDa Coix protein is a gene family and is distributed in clusters like gliadin in maize, but its specific composition and structure are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coix lacryma-jobi gliadin alpha-coixin gene, its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1: Cloning method of coixin α-coixin gene

[0019] 1. Obtaining method of positive BAC clone

[0020] According to the sequence of coixin (gi: 296507) obtained by NCBI, we designed two pairs of primers: coixin / P1, P2 (5'ttgtgctccttgctctttcag 3'; 5'cagataggcagcagggtttg 3'), and screened from the coix BAC library by PCR screening system BAC clones containing coixin. Two sequenced BAC clones were selected by Southern hybridization analysis.

[0021] Large-throughput extraction of plasmid DNA from the shotgun library was performed on the MegaBACE 4500 for sequence determination. Each shotgun plasmid is sequenced bidirectionally using M13 forward and reverse primers. The size of the above two BAC clones is 120k and 140k respectively, the usable sequence obtained by each sequencing reaction is 500bp, the success rate of obtaining the usable sequence is calculated as 75%, and a total of 3200 shotgun libraries are sequenced according to the requirement of 10 times co...

Embodiment 2

[0024] Gene prediction and homologous comparison of two BACs

[0025] The gene prediction program FGENESH (http: / / www.softberry.com) was used to predict the possible genes (model: monocot, ie monocot) in the sequence. The prediction results were used in GenBank of NCBI (National Center for Biotechnology Information, USA) using BLASTN and BLASTP ( http: / / www.ncbi.nlm.nih.gov / BLAST / ) program and found 17 α-coixin gene family members. See Figure 1.

Embodiment 3

[0026] Example 3: The expression and expression levels of α-coixin gene family members were studied by using random sequencing of reverse transcription products.

[0027] The coixin gene family members were amplified by RT-PCR with universal primers that can amplify each member gene. In order to ensure that the ratio of member genes is not changed during PCR amplification, the number of PCR cycles is strictly controlled in the linear amplification stage. Subsequently, the PCR product was cloned into the pMD 18-T vector and the clones were picked for sequencing. Since there is no intron in the coix α-gliadin gene, we compared the sequencing results with the sequences of each gene to determine their expression and the relative proportion of expressed member mRNA. The results are shown in Table 1 and Figure 2. Among them, 11 member genes are expressed, and the expression level of coixin-09 accounts for 18% of the total expression level, followed by coixin-08 and coixin-17 respec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a prolamin alpha-coixin gene in the Coix lacryma-jobi L. and coded protein and application, which contains one of the following nucleotide sequences: (1)DNA sequence as SEQ NO 1-18; (2)DNA sequence to code the same function as protein with consanguinity over 95% in the SEQ NO 1-18. The invention can modify the quality of seed protein of coix lacryma-jobi, which reaches the goal to cultivate superior maize (high lysine maize).

Description

technical field [0001] The invention relates to a prolamin α-coixin gene in Coix lacryma-jobi L., its encoded protein and its application. Background technique [0002] Coix (Coix) belongs to the Poaceae Coix genus, which is closely related to corn and belongs to the Maydeae family. Job's tears has a long history of cultivation in my country, and has long been used as a traditional Chinese medicinal material rather than a food crop. The planting area of ​​Job's tears in my country is the largest among medicinal crops, accounting for about one-fifth to one-fourth of the total planting area of ​​medicinal materials. It is also the most widely distributed, and it is cultivated almost all over the country. In recent years, it has been found that the coix seed contains coixenolide with a very unique structure, which has the effect of preventing and treating cancer, which also makes the study of coix arouse people's attention. [0003] Coix seed not only contains coixenolide, bu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82
Inventor 宋任涛许政暟黄彬彬王刚孟祥宗
Owner SHANGHAI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More