Coix lacryma-jobi gliadin alpha-coixin gene, its coding gene and application
A technology encoding protein and coixol, which can be applied in application, genetic engineering, plant genetic improvement, etc., and can solve problems such as unclear composition and structure
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Example 1: Cloning method of coixin α-coixin gene
[0019] 1. Obtaining method of positive BAC clone
[0020] According to the sequence of coixin (gi: 296507) obtained by NCBI, we designed two pairs of primers: coixin / P1, P2 (5'ttgtgctccttgctctttcag 3'; 5'cagataggcagcagggtttg 3'), and screened from the coix BAC library by PCR screening system BAC clones containing coixin. Two sequenced BAC clones were selected by Southern hybridization analysis.
[0021] Large-throughput extraction of plasmid DNA from the shotgun library was performed on the MegaBACE 4500 for sequence determination. Each shotgun plasmid is sequenced bidirectionally using M13 forward and reverse primers. The size of the above two BAC clones is 120k and 140k respectively, the usable sequence obtained by each sequencing reaction is 500bp, the success rate of obtaining the usable sequence is calculated as 75%, and a total of 3200 shotgun libraries are sequenced according to the requirement of 10 times co...
Embodiment 2
[0024] Gene prediction and homologous comparison of two BACs
[0025] The gene prediction program FGENESH (http: / / www.softberry.com) was used to predict the possible genes (model: monocot, ie monocot) in the sequence. The prediction results were used in GenBank of NCBI (National Center for Biotechnology Information, USA) using BLASTN and BLASTP ( http: / / www.ncbi.nlm.nih.gov / BLAST / ) program and found 17 α-coixin gene family members. See Figure 1.
Embodiment 3
[0026] Example 3: The expression and expression levels of α-coixin gene family members were studied by using random sequencing of reverse transcription products.
[0027] The coixin gene family members were amplified by RT-PCR with universal primers that can amplify each member gene. In order to ensure that the ratio of member genes is not changed during PCR amplification, the number of PCR cycles is strictly controlled in the linear amplification stage. Subsequently, the PCR product was cloned into the pMD 18-T vector and the clones were picked for sequencing. Since there is no intron in the coix α-gliadin gene, we compared the sequencing results with the sequences of each gene to determine their expression and the relative proportion of expressed member mRNA. The results are shown in Table 1 and Figure 2. Among them, 11 member genes are expressed, and the expression level of coixin-09 accounts for 18% of the total expression level, followed by coixin-08 and coixin-17 respec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
