Unlock instant, AI-driven research and patent intelligence for your innovation.

Hepatitis E virus fluorescent quantitative PCR detection method

A hepatitis E virus, fluorescence quantitative technology, applied in the field of bioengineering, can solve the problems of large difference in detection rate, different antigens, reduce missed detection rate and other problems, achieve high accuracy, low false positive rate, avoid The effect of pollution

Inactive Publication Date: 2008-02-13
ZHEJIANG ACAD OF MEDICAL SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity of ELISA to detect hepatitis E-specific antibodies is limited, and the antigens used are not the same, resulting in a large difference in the detection rate. With the increasing number of HEV genotypes discovered, more antigen detection reagents need to be synthesized , to reduce the missed detection rate
However, due to the very low virus content in clinical samples, the conventional RT-PCR method is not sensitive enough and is prone to missed detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatitis E virus fluorescent quantitative PCR detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Design primers and Taqman probes

[0044] Experimental steps:

[0045] The complete sequence of HEV was collected in Genbank and analyzed by bioinformatics, and the conserved segment of the sequence was selected as a candidate segment for designing primers and probes. D11092, L08816, L25547 and M94177), determined the highly conserved region located in ORF2 as the target gene sequence for PCR amplification. A pair of PCR primers and Taqman probes were designed using primer express software and primer premier5.0 software. The fluorescent reporter group at the 5' end of the probe was FAM, and the fluorescent quencher group labeled at the 3' end was TAMRA. Primers and probes are located in the ORF2 region, and the target amplified fragment is 151bp. The hepatitis E virus-specific quantitative PCR primer refers to an oligonucleotide chain with a length of 21 bp.

[0046] The primer and probe sequences are:

[0047] Upstream primer: HEV-1(+): GAATGCTCAGCAGGATAAGGGT;

[...

Embodiment 2

[0051] Construction and preparation of quantitative standards

[0052] Experimental procedure

[0053] 1. Construction of quantitative standards

[0054] The HEV gene fragment containing the target sequence was cloned by RT-PCR, recombined into the vector pET-28a, and the DNA sequence was determined. The constructed recombinant plasmid was used as a quantitative standard and named pET28a-ORF2.

[0055] 2. Preparation of Quantitative Standards

[0056] Plasmid pET28a-ORF2 was extracted and purified by alkaline cleavage method, and the OD measured by UV spectrophotometer 260 、OD 280 and OD 230 The value was used to calculate the plasmid concentration, detect the purity of the plasmid, and convert to copy number according to Avogadro constant.

[0057] Calculated as follows:

[0058] Plasmid concentration (μg / μl) = OD 260 × Dilution factor × 50 / 1000

[0059] Plasmid copy number = A*N / 1000M

[0060] A: represents the plasmid concentration (μg / μl);

[0061] M: represents...

Embodiment 3

[0064] Isolation and concentration of viruses in virus samples

[0065] Experimental procedure

[0066] 1. Virus Extraction and Concentration

[0067] (1). PBS with a pH of 7.4 was used to fully shake and mix with the feces samples of the acute phase of the hepatitis E patients to make a 10% feces suspension. If the virus content of the sample is high, continue to step 2 directly; if the virus content is low, continue to the following steps:

[0068] (2). After centrifuging at 4°C and 8000rpm for 10 minutes, take the supernatant;

[0069] (3). Continue to centrifuge at 12000rpm for 15min at 4°C, and take the supernatant;

[0070] (4). Add appropriate amount of PEG 6000 and sodium chloride to the supernatant, and let stand overnight at 4°C;

[0071] (5). Centrifuge at 12,000 rpm for 15 minutes at 4°C to obtain a precipitate, and use Trizol to extract RNA from the precipitate.

[0072] 2. Viral Nucleic Acid Extraction

[0073] (1). Add 1ml Trizol to every 150μl of 10% fece...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a test method in the bioengineering field, in particular to a fluorescence quantitative PCR test method used for quantitatively test the titer of Hepatitis E virus (HEV) in a clinical specimen. The steps of invention include the design of virus specific quantitative PCR primers and probes, the construction of standard molecular, the extraction of a virus sample RNA, the cDNA synthesis of the sample RNA and the establishment and optimization of the fluorescence quantitative PCR test method. The testing sensitivity of the invention can reach to 10 degrees magnitude virus copy. The invention is equipped with good stability and specificity, which can be used for mass samples test and is capable of precisely measuring the virus load of the sample.

Description

technical field [0001] The invention relates to a detection method in the field of bioengineering, in particular to a fluorescent quantitative PCR detection method for quantitative detection of hepatitis E virus titer in clinical specimens. Background technique [0002] Hepatitis E is an acute, self-limiting disease caused by hepatitis E virus (HEV). The virus is mainly transmitted through the fecal-oral route, and is widely prevalent in developing countries, mainly invading young adults, and the mortality rate of pregnant women after infection can reach more than 20%, which constitutes a serious public health problem. my country is a high-incidence area of ​​hepatitis E, and it is urgent to control the disease. At present, in addition to clinical symptoms, the diagnosis of hepatitis E usually uses ELISA method to detect anti-HEV-IgG antibody in serum. However, the current ELISA detection sensitivity and specificity are low, and the missed detection rate is high, which bri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N21/00C12Q1/68C12Q1/70
Inventor 陈勇沃恩康洪艳王怡婷
Owner ZHEJIANG ACAD OF MEDICAL SCI