Anti-HER2 single-chain antibody-cefuroxime sodium enhanced fusion protein HER2(Fv-LDM)

A fusion protein, lidamycin technology, applied in the field of strengthening fusion protein HER2, to achieve the effects of small molecular weight, good clinical application prospects, and tumor-inhibiting activity

Inactive Publication Date: 2008-03-19
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there have been no related reports so far that couple the single-chain antibody of HER2 with lidamycin as a strengthened fusion protein HER2 (Fv-LDM) for anti-tumor-oriented drugs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-HER2 single-chain antibody-cefuroxime sodium enhanced fusion protein HER2(Fv-LDM)
  • Anti-HER2 single-chain antibody-cefuroxime sodium enhanced fusion protein HER2(Fv-LDM)
  • Anti-HER2 single-chain antibody-cefuroxime sodium enhanced fusion protein HER2(Fv-LDM)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] . Construction and screening of HER2 phage antibody library

[0105] 1.1 Antigen protein expression, purification and mouse immunization:

[0106] Utilize PGEX2T vector (Pharmacia product) to express HER2 extracellular domain protein in Escherichia coli BL21 (Invitrogen product), specific method refers to Han Mei et al. [Ningxia Medical Journal, 2001; 23 (3): 131-133], the optimal induction time was 4h, the induction temperature was 37°C, and the IPTG concentration was 0.8mM. The extracellular segment of GST-HER2 is expressed in the form of inclusion bodies with a molecular weight of about 70kD. After renaturation by dialysis, it is purified with a GST-Sephrose4B column (Pharmacia product) (Figure 1). Purified HER2 extracellular segment protein 100 μg / mouse, immunized 3 female BALB / c mice of 6-8 weeks. Immunization was boosted once every two weeks thereafter. Orbital blood was collected 3 days after each booster immunization, and the purified recombinant HER2 extrace...

Embodiment 2

[0110] . Construction of HER2 (Fv-LDP) fusion protein recombinant expression plasmid

[0111] The recombinant plasmid PET-30A(+)-LDP contains the LDP gene and is preserved by our laboratory. The recombinant phagemid PCANTAB-5E contains the scFv gene, and two enzyme cutting sites, Nde I and EcoR I, are introduced by PCR. PET-30A(+)-30a Vector is a product of Novagen. PCR primers were synthesized by Invitrogen. The corresponding enzyme cutting sites were introduced respectively.

[0112] ScFv 5' end primer (PH1): 5'GATA CATATG GCCCAGGTCAAGCTGCAG3'

[0113] Nde I

[0114] ScFv 3' end primer (PL2): 5'CG GAATTCGGATCCGCCACCGCC CCGTTTTATTTTCCAACTT3'

[0115] EcoR I spacer

[0116]Using the recombinant phagemid PCANTAB5E-scFv as a template, PH1 as the 5' end primer, and PL2 as the 3' end primer, PCR amplification was performed to obtain a single-chain antibody gene fragment with a small peptide spacer at the C-terminus....

Embodiment 3

[0117] . Fusion protein HER2 (Fv-LDP) in Escherichia coli BL21 (DE3) star TM inducible expression

[0118] The identified recombinant plasmid was transformed into Escherichia coli BL21(DE3)star TM Randomly pick recombinant transformants and inoculate them into 3ml of LB medium containing 50μg / ml kanamycin, shake and culture overnight at 37°C; inoculate at a ratio of 1:50 the next day, shake and culture at 37°C until the OD600 is 0.8, add IPTG to a final concentration of 0.8mM, induction culture for 4-6h, take an appropriate amount of bacterial liquid, and analyze the expression product localization of the whole bacteria, medium supernatant, periplasmic cavity components, soluble cytoplasmic components and inclusion bodies. The expression of exogenous protein was analyzed by 12% SDS-PAGE electrophoresis, and the fusion protein was expressed in the periplasmic cavity in a soluble form. Quantitative analysis of the gel imaging system showed that the expression level of the fusi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Gene lengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to a reinforced fusion protein HER2 (Fv-LDM), which is composed of anti HER2 single-chain antibody scFv, fusion protein HER2 (Fv-LDP) with molecular weight of 40 kDa, which is formed by lidamycin prosthetic group protein LDP and the histidine hexamer tail of the carboxyl terminal, and activated enediyne chromophore AE with molecular weight of 843 Da, and gene is 1110 bp in length and encodes 369 amino acids. The results of in vivo and in vitro experiments show that the reinforced fusion protein has an obvious lethal effect on in vivo and in vitro tumor cells with high HER2 expression and can be developed into a high-performance miniaturized antibody-targeted drug.

Description

Technical field: [0001] The invention relates to a strengthened fusion protein HER2 (Fv-LDM). Specifically, the strengthened recombinant protein involved contains an anti-HER2 single-chain antibody and the amino acid sequence of the lidamycin prosthetic protein and the amino acid sequence combined with the lidamycin prosthetic protein. Based protein-bound enediyne chromophores can be used as novel antibody-directed drugs for tumor therapy. Background technique: [0002] Breast cancer is one of the most common malignant tumors in women, and its incidence is increasing year by year. There is an urgent need to adopt new treatment methods (including new drugs) to improve the survival rate and quality of life of patients. The role of molecular targeted therapy in tumor therapy is rising day by day, and it has become a new hotspot in tumor therapy. At present, a variety of molecular targeted therapy drugs have been used in the treatment of breast cancer or are in clinical trials,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N1/21A61K38/16A61P35/00
Inventor崔向丽甄永苏李英苗庆芳张胜华陈静
OwnerMEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI