Method of preparing recombination human source catalase and application thereof
A catalase, human-derived technology, applied in biochemical equipment and methods, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve problems such as source limitation, disease source pollution, and inability to meet extensive uses, To achieve the effect of simple production method, no disease source pollution and high yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1 Construction of pPIC9k-CAT expression plasmid
[0060] Extraction of CDNA from Human Embryonic Hepatocytes
[0061] 1 g of fresh human embryonic liver tissue was frozen in liquid nitrogen, ground and finely ground, and RNA was extracted with an RNA extraction kit purchased from Shanghai Bioengineering Company. The total cDNA was obtained from the RNA solution by RT-PCR using a CDNA reverse transcription kit purchased from Shanghai Bioengineering Company.
[0062] Amplification of the gene encoding human liver catalase
[0063] Synthesis of 5' end and 3' end primers: According to the full-length human liver cDNA [gi: 50490312] released in NCBI gene bank in 2004, find out the ORF sequence and design primers.
[0064] Synthesize the 5' end primer: TACGTA ATGGCTGACAGCCGGGATCC, this sequence contains SNABI restriction site. 3' end primer: CCG GCGGCCGC TCACAGATTTGCCTTCTCC, this sequence contains NotI restriction site.
[0065] PCR amplification: Take 1 μL...
Embodiment 2
[0070] Example 2 pPIC9k-CAT expression plasmid transformation and positive strain screening
[0071] The obtained pPIC9k-CAT expression plasmid was digested with Bgl II at 37 degrees for 2 hours and linearized completely, precipitated with absolute ethanol, centrifuged at 10,000 RPM, discarded the supernatant, evaporated the remaining ethanol, and dissolved it with sterile water. Take 5 μL and 80 μL of freshly prepared yeast SMD1168 (commercially purchased) in a competent state and mix well. For details, refer to the electroporation protocol of Invitrogen Company, and electroporation is introduced. Resuscitate the electroporated bacterial solution at 30°C for 1 hour, spread it on an MD plate, grow at 30°C for 3-5 days, connect the grown white clone to a YPD plate containing 4 mg / ml G418 for resistance screening, and screen High-copy recombinant bacterium pichia pastoris, the obtained recombinant bacterium was lysed by boiling-freezing-boiling method, and genomic DNA was extrac...
Embodiment 3
[0072] Example 3 Screening of positive recombinant bacteria with high expression activity and overexpression of human source catalase
[0073] Put the obtained positive recombinant bacteria and original bacteria in 5ml BMGY medium, 250RPM, 30 degrees Celsius, grow for 24 hours, centrifuge at 4000RPM, change BMMY medium, induce with 1% methanol, add once every 24 hours, culture conditions Ditto. After the bacterial liquid was centrifuged at 10000 RPM, the catalase activity of the supernatant was observed, and the highly active strain of Pichia pastoris methanolica (Fudan s4) was obtained by screening.
[0074] High-efficiency expression of the S4 high-yielding strain was carried out in a 14L fully automatic fermenter. In BS medium, 30 degrees Celsius, 40% dissolved oxygen, stirring 400RPM, pH 6.8, and induced by methanol for 36 hours, the activity reached the highest, and its expression Vitality takes bovine liver catalase (sigma company) as a control, reaching 220 mg equivale...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
