Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method of preparing recombination human source catalase and application thereof

A catalase, human-derived technology, applied in biochemical equipment and methods, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve problems such as source limitation, disease source pollution, and inability to meet extensive uses, To achieve the effect of simple production method, no disease source pollution and high yield

Inactive Publication Date: 2008-03-26
FUDAN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, some studies intend to extract catalase from human tissue, but due to the limited source and the pollution of disease sources, it cannot meet the wide clinical use
At present, there are still reports on the expression and preparation of human catalase in expression systems such as bacteria, yeast, and insects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of preparing recombination human source catalase and application thereof
  • Method of preparing recombination human source catalase and application thereof
  • Method of preparing recombination human source catalase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Construction of pPIC9k-CAT expression plasmid

[0060] Extraction of CDNA from Human Embryonic Hepatocytes

[0061] 1 g of fresh human embryonic liver tissue was frozen in liquid nitrogen, ground and finely ground, and RNA was extracted with an RNA extraction kit purchased from Shanghai Bioengineering Company. The total cDNA was obtained from the RNA solution by RT-PCR using a CDNA reverse transcription kit purchased from Shanghai Bioengineering Company.

[0062] Amplification of the gene encoding human liver catalase

[0063] Synthesis of 5' end and 3' end primers: According to the full-length human liver cDNA [gi: 50490312] released in NCBI gene bank in 2004, find out the ORF sequence and design primers.

[0064] Synthesize the 5' end primer: TACGTA ATGGCTGACAGCCGGGATCC, this sequence contains SNABI restriction site. 3' end primer: CCG GCGGCCGC TCACAGATTTGCCTTCTCC, this sequence contains NotI restriction site.

[0065] PCR amplification: Take 1 μL...

Embodiment 2

[0070] Example 2 pPIC9k-CAT expression plasmid transformation and positive strain screening

[0071] The obtained pPIC9k-CAT expression plasmid was digested with Bgl II at 37 degrees for 2 hours and linearized completely, precipitated with absolute ethanol, centrifuged at 10,000 RPM, discarded the supernatant, evaporated the remaining ethanol, and dissolved it with sterile water. Take 5 μL and 80 μL of freshly prepared yeast SMD1168 (commercially purchased) in a competent state and mix well. For details, refer to the electroporation protocol of Invitrogen Company, and electroporation is introduced. Resuscitate the electroporated bacterial solution at 30°C for 1 hour, spread it on an MD plate, grow at 30°C for 3-5 days, connect the grown white clone to a YPD plate containing 4 mg / ml G418 for resistance screening, and screen High-copy recombinant bacterium pichia pastoris, the obtained recombinant bacterium was lysed by boiling-freezing-boiling method, and genomic DNA was extrac...

Embodiment 3

[0072] Example 3 Screening of positive recombinant bacteria with high expression activity and overexpression of human source catalase

[0073] Put the obtained positive recombinant bacteria and original bacteria in 5ml BMGY medium, 250RPM, 30 degrees Celsius, grow for 24 hours, centrifuge at 4000RPM, change BMMY medium, induce with 1% methanol, add once every 24 hours, culture conditions Ditto. After the bacterial liquid was centrifuged at 10000 RPM, the catalase activity of the supernatant was observed, and the highly active strain of Pichia pastoris methanolica (Fudan s4) was obtained by screening.

[0074] High-efficiency expression of the S4 high-yielding strain was carried out in a 14L fully automatic fermenter. In BS medium, 30 degrees Celsius, 40% dissolved oxygen, stirring 400RPM, pH 6.8, and induced by methanol for 36 hours, the activity reached the highest, and its expression Vitality takes bovine liver catalase (sigma company) as a control, reaching 220 mg equivale...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of biotechnology, and is especially process of preparing recombinant humanized catalase. The process of obtaining humanized catalase in high yield includes cloning humanized catalase gene by means of gene engineering technology, constructing its expression plasmid and transforming to cell. The process is simple and has no disease contamination and high yield of humanized catalase, and the prepared humanized catalase has high activity. The present invention includes also the new recombinant plasmid and transformant. Experiments show that the expressed recombinant humanized catalase may be applied in preparing medicine for resisting infection, resisting oxidation, resisting senility and antagonizing tumor.

Description

Technical field: [0001] The invention relates to a method for preparing human catalase. Specifically, the present invention provides a method for cloning human catalase gene by genetic engineering technology, constructing its expression plasmid, and transforming cells to obtain high-yield human catalase. technical background: [0002] Catalase is a kind of enzyme widely distributed in aerobic organisms in nature, which can efficiently catalyze hydrogen peroxide to generate molecular oxygen and water. During cellular respiration, part of the oxygen is reduced to H 2 o 2 , H 2 o 2 It is easily reduced by intracellular reducing agents to the strongest oxidant in the body, OH free radicals, which can also be produced by Fenton reaction and Harbe Weiss reaction in the body. In pathological conditions, H 2 o 2 Accumulation will cause excessive OH, resulting in serious oxidative damage, catalase can eliminate the H produced by the body's metabolism 2 o 2 , to block the acc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/08C12N15/09C12N1/19A61K38/44A61P35/00A61P17/02A61P17/18
Inventor 周珮史训龙冯美卿黄海李继扬
Owner FUDAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More