DNA detection method based on gene chip with nanometer gold detecting probe
A nano-gold probe and gene chip technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of large amount of nano-gold labeled probes and cumbersome hybridization process, so as to facilitate popularization and improve reliability. Noise ratio, increased stability effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Utilize the detection method of the gene chip based on nano gold probe provided by the present invention to detect the synthetic target single strand, the sensitivity of detection target single strand DNA is 10 -12 M.
[0030] 1. Reagents and materials used:
[0031] 1) Preparation of gene chip
[0032] The chip spotter model is Prosys 5510A, the chip spot diameter is 100 μM, the spot spacing is 500 μM, the sample volume is 0.7 nl, and the DNA probe concentration is 75 μM.
[0033] 2) 0.1MPBS washing solution (PH7.2): 137mmol / L NaCl, 2.7mmol / L KCl, 4.3mmol / LNa 2 HPO 4 .7H2O, 1.4mmol / L KH 2 PO 4 .
[0034] 3) 0.1MPB (PH7.2): 0.2M Na 2 HPO 4 , 0.2M NaH 2 PO 4 .
[0035] 4) TE buffer solution (PH7.4): 10mmol / L Tris-HCl, 1mmol / L ethylenediaminetetraacetic acid sodium (EDTA).
[0036] 5) Hybridization buffer: 0.3M NaCl, 10mM PB, 0.01% SDS, 0.025% Tween20.
[0037] 6) NaNO 3 Lotion: 0.3M NaNO 3 , 10 mM PB, 0.01% SDS, 0.025% Tween20.
[0038] 7) Silver staining...
Embodiment 2
[0049] Detecting wild-type p53 gene and p53 gene with 248-site mutation by using nano-gold-based gene chip detection method
[0050] 1) The required probe sequence:
[0051] The signal probe sequence for labeling gold nanoparticles is:
[0052] 5'TGGAAGACTCCAGGTCAGGAGCC AC-A10-(CH2)6-SH 3', the capture probe sequence for detecting wild-type p53 is: 5'NH2-(CH2)6-T10-GGCATGAACCGGAGGCCCAT 3.', the capture probe for detecting mutant p53 The needle sequence was 5'NH2-(CH2)6-T10-GGCATGAACCTGAGGCCCAT 3.', and all probes were synthesized by TaKaRa Company.
[0053] 2) Extraction of human tissue genomic DNA and PCR amplification of p53 gene
[0054] For the detailed method of extracting human genomic DNA, refer to the second edition of "Molecular Cloning Experiment Guide", 1996, published by Science Press, edited by (USA) Samburu et al., and translated by Jin Dongyan et al. The primer sequences for P53 gene amplification are: primer 1: 5'-TCT TGGGCC TGT GTT ATC TC-3', primer 2: 5'-A...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 