DNA detection method based on gene chip with nanometer gold detecting probe

A nano-gold probe and gene chip technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of large amount of nano-gold labeled probes and cumbersome hybridization process, so as to facilitate popularization and improve reliability. Noise ratio, increased stability effect

Active Publication Date: 2008-05-21
SHANGHAI INST OF MICROSYSTEM & INFORMATION TECH CHINESE ACAD OF SCI
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The technical problems to be solved are mainly aimed at the current problems such as

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA detection method based on gene chip with nanometer gold detecting probe
  • DNA detection method based on gene chip with nanometer gold detecting probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Utilize the detection method of the gene chip based on nano gold probe provided by the present invention to detect the synthetic target single strand, the sensitivity of detection target single strand DNA is 10 -12 M.

[0030] 1. Reagents and materials used:

[0031] 1) Preparation of gene chip

[0032] The chip spotter model is Prosys 5510A, the chip spot diameter is 100 μM, the spot spacing is 500 μM, the sample volume is 0.7 nl, and the DNA probe concentration is 75 μM.

[0033] 2) 0.1MPBS washing solution (PH7.2): 137mmol / L NaCl, 2.7mmol / L KCl, 4.3mmol / LNa 2 HPO 4 .7H2O, 1.4mmol / L KH 2 PO 4 .

[0034] 3) 0.1MPB (PH7.2): 0.2M Na 2 HPO 4 , 0.2M NaH 2 PO 4 .

[0035] 4) TE buffer solution (PH7.4): 10mmol / L Tris-HCl, 1mmol / L ethylenediaminetetraacetic acid sodium (EDTA).

[0036] 5) Hybridization buffer: 0.3M NaCl, 10mM PB, 0.01% SDS, 0.025% Tween20.

[0037] 6) NaNO 3 Lotion: 0.3M NaNO 3 , 10 mM PB, 0.01% SDS, 0.025% Tween20.

[0038] 7) Silver staining...

Embodiment 2

[0049] Detecting wild-type p53 gene and p53 gene with 248-site mutation by using nano-gold-based gene chip detection method

[0050] 1) The required probe sequence:

[0051] The signal probe sequence for labeling gold nanoparticles is:

[0052] 5'TGGAAGACTCCAGGTCAGGAGCC AC-A10-(CH2)6-SH 3', the capture probe sequence for detecting wild-type p53 is: 5'NH2-(CH2)6-T10-GGCATGAACCGGAGGCCCAT 3.', the capture probe for detecting mutant p53 The needle sequence was 5'NH2-(CH2)6-T10-GGCATGAACCTGAGGCCCAT 3.', and all probes were synthesized by TaKaRa Company.

[0053] 2) Extraction of human tissue genomic DNA and PCR amplification of p53 gene

[0054] For the detailed method of extracting human genomic DNA, refer to the second edition of "Molecular Cloning Experiment Guide", 1996, published by Science Press, edited by (USA) Samburu et al., and translated by Jin Dongyan et al. The primer sequences for P53 gene amplification are: primer 1: 5'-TCT TGGGCC TGT GTT ATC TC-3', primer 2: 5'-A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention relates to a high-sensibility DNA detection method based on the gene chip of nanosized gold probe; the method is characterized in that the nanosized gold is centrifugally condensed and enriched with a low temperature and then sterile deionized water or TE (pH7.4) is used for re-suspension according to a consistency; and then the nanosized gold is added with an amount of DNA signal probes which is used for modifying hydrosulphonyl; in this way, the amount of the DNA used for modifying the hydrosulphonyl is greatly saved; after the mark is made, the mark and the detected object molecules are placed on the chip for one-step crossbreed; the capture probes of the detected DNA and the chip and the signal probes for marking the nanosized gold are used for the crossbreed at the same time; and then the chip is washed and dried after the crossbreed and improved silver stein preparation is added on the chip for silver stein color development; in this way, the crossbreed signal strength is greatly enhanced and the detection sensibility is promoted; people can observe with naked eyes or use CCD for scanning and taking pictures. The detection method provided by the invention is characterized by greatly reduced DNA probe number, high sensibility and convenient signal detection.

Description

technical field [0001] The invention relates to a DNA detection method of a gene chip, in particular to a high-sensitivity DNA detection method of a gene chip based on a gold nanometer probe, which can be applied to the medical field. Background technique [0002] Gene chips are formed by using the intensive and parallel processing principles of microelectronic chip technology to orderly solidify a large number of biological samples with characteristic sequences of biological significance on silicon substrates or glass. Gene chips can be used to quickly obtain or process A large amount of life information (including gene identification, gene mutation detection, gene expression profile detection, etc.), which has been successfully applied in the fields of gene expression, gene mutation, gene polymorphism research and gene diagnosis. [0003] At present, the detection methods of gene chip hybridization results mainly include fluorescence labeling detection method and isotope l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
Inventor 贾春平赵建龙毛红菊金庆辉
Owner SHANGHAI INST OF MICROSYSTEM & INFORMATION TECH CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap