Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing replication defect type recombination adenovirus

A recombinant adenovirus, replication-deficient technology, applied in the field of biomedicine, can solve problems such as weakening the therapeutic effect, and achieve the effect of wide clinical application value

Inactive Publication Date: 2008-05-28
THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] As the molecular basis of the body's resistance to various injuries, the DNA damage repair system plays a vital role in maintaining the stability and integrity of the genome. However, for radiotherapy and chemotherapy that kill cancer cells by damaging DNA, this process undoubtedly weakens the therapeutic effect. Effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing replication defect type recombination adenovirus
  • Method for constructing replication defect type recombination adenovirus
  • Method for constructing replication defect type recombination adenovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction and Identification of APE1 siRNA Adenovirus Shuttle Plasmid

[0041] According to the effective human APE1 siRNA sequence designed by us [4], the Ambion siRNA target sequence analysis and design system was used to scan the cDNA coding sequence of the human APE1 gene with the gene number NM_001641. According to the siRNA target sequence selection design principle, the BLAST sequence homology After the analysis, select the specific siRNA target sequence of 867-885 in the human APE1 gene cDNA coding sequence, and design the expression sequence of the human APE1 gene siRNA. , HindIII restriction site sticky end, chemical synthesis of the following two complementary single strands:

[0042] Top strand:

[0043] 5′-GATCCGCTGGTACGACTGGAGTACCTTTCAAGAGAGGTACTCCAGTCGTACCAGACTTTTT

[0044] TTGGAAA-3';

[0045] Bottom strand:

[0046] 5′-AGCTTTTCCAAAAAAGTCTGGTACGACTGGAGTACCTCTCTTGAAGGTACTCCAGTCGT

[0047] ACCAG CG-3′

[0048] The aforementioned compleme...

Embodiment 2

[0049] Example 2 Ad5 / F35-APE1siRNA recombinant adenovirus packaging, amplification and purification 2.1 Ad5 / F35-APE1siRNA recombinant adenovirus packaging

[0050] Packaging principle and flow chart: The recombinant adenovirus is constructed using the adenovirus Ad5 / F35MaxTM packaging system of Benyuan Zhengyang Company. The shuttle plasmid pDC316-EGFP-U6-APE1siRNA carrying the human APE1 gene siRNA expression sequence and the adenovirus backbone plasmid pBHG-fiber5 / 35 were co-transfected into 293 cells. Plasmids are combined, and Cre / loxP system is used to perform site-directed recombination in 293 cells to produce Ad5 / F35-APE1 siRNA recombinant adenovirus with human APE1 gene siRNA expression sequence. The recombinant virus obtained in this way is a replication-deficient adenovirus with E1 deletion, and the virus can only realize the expression of foreign genes in cells that cannot provide the E1 region, but does not have the ability to proliferate. The packaging process of...

Embodiment 3

[0072] Example 3 Infection Efficiency of Ad5 / F35-APE1siRNA Recombinant Adenovirus to Colorectal Cancer Cells

[0073] 3.1 Detection of Infection Efficiency in Vitro

[0074] LOVO cells were cultured in an incubator containing 5% CO2 at 37°C, and the culture medium RPMI1640 contained 10% FCS, 1.0×10 5 U / L penicillin and streptomycin. The day before adenovirus infection, LOVO cells were seeded in a six-well plate, 5×10 per well 5 cells. Infect LOVO cells with adenovirus Ad5 / F35-APE1siRNA or control adenovirus Ad5 / F35-EGFP and Ad5-EGFP at a multiplicity of infection (MOI) of 0-20 for 90 min, then discard the culture medium and replace with complete medium After 24h, the expression of EGFP in LOVO cells was observed under a fluorescent inverted microscope and photographed. Digest the cells with 0.25% trypsin, centrifuge at 500g for 5min at room temperature, discard the supernatant, resuspend the cells in 0.01MPBS, centrifuge at 500g for 5min at room temperature, collect the ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of replication-deficient recombinant adenovirus. Firstly, a double-stranded expression module of siGNA of the gene APE1 of human being is chemically synthesized and inserted under the prompter U6 of the shuttle plasmid of the adenovirus after restriction enzyme, then shuttle plasmid pDC316-EGFP-U6-APE1siRNA is constructed, and then shuttle plasmid pDC316-EGFP-U6-APE1siRNA and the bone plasmid of adenovirus pBHG-fiber5 / 35 are simultaneously cotransfected into cell 293, consequently the recombinant adenovirus Ad5 / F35-APE1siRNA with the expression sequence of siGNA of the gene APE1 of human being is achieved through the fixed-point recombination produced by the system function of Cre / loxP. The recombinant adenovirus is capable of effectively preventing the expression of the gene APE1 and effectively strengthening the sensibility of radiotheraphy and chemotherapy of tumour cell.

Description

technical field [0001] The present invention relates to the field of biomedicine. Specifically, the present invention relates to a method for constructing a replication-deficient recombinant adenovirus, which involves inserting foreign DNA fragments into the Ad5 / F35 adenovirus vector to construct a recombinant adenovirus, which can effectively inhibit the expression of the APE1 gene in tumor cells , can effectively enhance the sensitivity of tumor cells to radiotherapy and chemotherapy. Background technique [0002] As the molecular basis of the body's resistance to various injuries, the DNA damage repair system plays a vital role in maintaining the stability and integrity of the genome. However, for radiotherapy and chemotherapy that kill cancer cells by damaging DNA, this process undoubtedly weakens the therapeutic effect. Effect. Therefore, gene therapy targeting DNA damage repair genes is expected to effectively enhance the sensitivity of tumor cells to radiotherapy an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/12
Inventor 向德兵王东陈正堂谢家印李梦侠仲召阳
Owner THE THIRD AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIV OF PLA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More