Method for breeding transgenic crop with iron/zinc and nicotinamide rich grains and uses thereof

A technology of nicotinamide and crops, which is applied in the field of crop breeding and genetic engineering, can solve the problems of high cost, expression of NAS gene, difficulty in promotion, etc., achieve great application prospects, improve iron bioavailability, and alleviate iron-deficiency malnutrition Effect

Inactive Publication Date: 2008-06-18
ZHEJIANG UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since these iron-fortified preparations do not exist naturally, they have high costs when used as food additives, and it is difficult to promote them in my country or other developing countries.
There is no report on the expression of NAS gene in rice endosperm to improve rice iron content and availability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for breeding transgenic crop with iron/zinc and nicotinamide rich grains and uses thereof
  • Method for breeding transgenic crop with iron/zinc and nicotinamide rich grains and uses thereof
  • Method for breeding transgenic crop with iron/zinc and nicotinamide rich grains and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1, the isolation of rice nicotinamide synthetase gene:

[0068] Through data mining of the rice gene bank, we obtained the sequence of the rice nicotinamide synthase gene (OsNAS1, gene bank sequence number AB046401), as shown in SEQ ID NO: 1; and the rice glutenin synthase gene promoter (GluB -1, GenBank sequence number AY427569), as shown in SEQ ID NO:2. And according to these two sequence design primers, this primer sequence is as follows:

[0069] OsNAS1-U: AACCATGGAGGCTCAGAACCAAGA

[0070] OsNAS1-L: TATCTAGA GATCGTCCGGCTGTTAGAC

[0071] GluB-U: ATGAATTCTTGCTACCAACAACTTCAC

[0072] GluB-L: AACCATGGGCTGGGCCATAGAACCGTGGCATA

[0073] Then, the above two DNA sequences, ie, SEQ ID NO: 1 and SEQ ID NO: 2, were amplified from rice cDNA and genomic DNA respectively by using a polymerase chain reaction program.

Embodiment 2

[0074] Embodiment 2, construction of endosperm-specific expression transgene vector:

[0075]The binary vector pTF101.1 (Figure 1) is a plant transgenic vector mediated by Agrobacterium, in which there is a complete selection marker gene expression cassette, that is, glufosinate driven by a double 35S promoter resistance gene. There is a multiple cloning site available for gene cloning on the side of the gene expression frame. In this experiment, the rice gluten synthase gene promoter GluB-1 and the Agrobacterium tumefaciens nopaline synthase gene terminator Tnos (such as SEQ ID NO: 3 shown) to obtain the intermediate vector pLU10 (Fig. 2); between the GluB-1 promoter and the Tnos terminator of the intermediate vector pLU10, the rice nicotinamide synthetase gene (OsNAS1) was forward inserted to obtain the final vector pLU14 for transgenic use ( figure 2).

Embodiment 3

[0076] Embodiment 3, rice transformation:

[0077] The binary transgenic vector pLU14 and its blank vector pLU10 were transformed into Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice. Mature seeds of Xiushui 110 were dehulled and sterilized, and after being cultured in induction medium for 3 weeks, vigorously growing calli were selected as recipients for transformation. The rice callus was infected with the EHA105 strain containing the binary plasmid vector, cultured in the dark at 25°C for 3 days, and then selected on the selection medium containing 2 mg / L bialaphos (bialaphos) for four weeks to obtain resistant callus. The wounded tissue was differentiated and regenerated to obtain transgenic seedlings. After the seedlings were sprayed with 100mg / L of glufosinate on the leaves to remove the false positive seedlings, the transgenic seedlings were transferred to the solution culture for 2 weeks, and then transplanted to the paddy field cultivation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a cultivation method of a transgenic crop, the grain of which is rich in iron or zinc and nicotinamide, comprising the steps as follows: firstly, nicotinamide synthetase gene is selected, and a prompter and a terminator of endosperm specific expression gene are selected; secondly, the construction of an transgenic vector of endosperm specific expression is that the prompter of the endosperm specific expression gene, the nicotinamide synthetase gene and the terminator used for commonly used plant expression are in forward series connection to obtain a gene expression cassette that crop endosperm expressively expresses NAS gene and accordingly to obtain the transgenic vector; thirdly, transgenic gene crop is cultivated. The method is adopted, which can improve the content of iron and zinc and the content of NA in the grains of the crop and accordingly the crop containing high biological effective iron element is obtained. The present invention also discloses the purpose of the transgenic crop that the obtained grains are used as food additive to be added into food or feed, so as to improve the iron absorption rate of the food or the feed.

Description

technical field [0001] The invention belongs to the fields of crop breeding and genetic engineering, and particularly relates to a new rice transgenic material, related genes and functions; specifically, it relates to a transgenic rice cultivated after overexpressing the nicotinamide synthetase (NAS) gene in endosperm and its production in rich Application of iron and zinc health care. Background technique [0002] Although the content of trace elements such as iron and zinc is very small, they are the constituents of 50%-70% of the enzymes in the human body, and they play an irreplaceable role in maintaining normal life activities. Due to unreasonable diet structure and lifestyle, iron and zinc micronutrient deficiency has become an important factor affecting human health, known as "second hunger". According to reports, 66% to 80% of the world's population may have iron deficiency, of which 2 billion people are anemic, mainly caused by iron deficiency [1,2]; iron deficienc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/52C12N15/82A23L1/16A23L1/30A23L7/109
Inventor寿惠霞吴平郑录庆郑晔程龙军雷新根贝晓姝
OwnerZHEJIANG UNIV