Construction method of onion pseudomonas genetic engineering bacteria

A technology of Pseudomonas cepacia and genetically engineered bacteria, applied in the field of genetic engineering, can solve problems such as low efficiency and yield, inactive heterologous expression of Pseudomonas cepacia lipase, and unclear metabolic regulation mechanism, etc., to achieve Good low-carbon alcohol tolerance and high temperature resistance, high expression and catalytic activity

Inactive Publication Date: 2009-02-04
HUAZHONG UNIV OF SCI & TECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Pseudomonas cepacia lipase needs to be expressed correctly with the help of its own molecular chaperone, and its secretion is also closely related to more than a dozen proteins such as the intracellular Dsb complex. Due to the lack of corresponding expression and secretion mechanisms,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of onion pseudomonas genetic engineering bacteria
  • Construction method of onion pseudomonas genetic engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0017] Example 1: Construction of lipase genetically engineered bacteria.

[0018] 1. Construction of Homologous Recombination Engineering Bacteria

[0019] 1) Cloning of related genes

[0020] PCR method was used to amplify T7 RNA polymerase gene, lipase gene upstream segment (homologous recombination segment gene 1) and lipase gene downstream segment (homologous recombination segment gene 2), Tmp resistance gene, lipase and its partner gene.

[0021] Primers for T7 RNA polymerase gene

[0022] Upstream primer 5': CTT CTGCAG ATGAACACGATTAACATCGCT

[0023] Downstream primer 5': CTTCTGCAG TTACGCGAACGCGAAGTCCGA

[0024] Primer for homologous recombination segment gene 1

[0025] Upstream primer 5': CTTGCGGCCGC AGCATCGCTACGCGCTGAAC

[0026] Downstream primer 5': CTTCTGCAG GCATGTTCTCCTGATTATTG

[0027] Primer for homologous recombination segment gene 2

[0028] Upstream primer 5': CTTCTGCAG AGATGTTGCTCGATGGTG

[0029] Downstream primer 5': CTTCTCGAG GTGATCTACGTCGGCAGTCT ...

example 2

[0070] Example 2: Recombinant bacteria are suitable for the expression of the α-amylase gene regulated by the T7 promoter

[0071] 1. Acquisition of α-amylase gene

[0072] Primer

[0073] Upstream primer 5': AAAGGATCC ACC ATC CTT CAT GCC TGGA

[0074] Downstream primer 5': CTTAAGCTT TTA ATG AGG AAG AGA ACC CGCT

[0075] Using Bacillus subtilis XL-15 genome DNA as a template, the α-amylase gene was amplified by PCR. An XbaI restriction site was added to the upstream primer, a HindIII restriction site was added to the downstream primer, and the PCR amplification product was simultaneously digested with XbaI and HindIII and cloned into the expression vector pBBR22b to obtain pBBR22AMY.

[0076] 2. α-amylase expression vector transforms Pseudomonas cepacia.

[0077] The pBBR22AMY expression plasmid was introduced into the constructed Pseudomonas cepacia strain containing T7 RNA polymerase gene to obtain α-amylase expression engineering bacteria. The detailed ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a method for constructing a genetically engineered bacterium from Pseudomonas cepacia, which replaces the lipase in the genome of Pseudomonas cepacia G63 and a chaperone gene with T7 RNA polymerase genes thereof, so that the T7 RNA polymerase genes are integrated into the genome of Pseudomonas cepacia and controlled by a lipase promoter. Afterwards, the Pseudomonas cepacia lipase and the chaperone gene thereof are cloned into expression plasmid containing T7 promoters and LacI repressor protein, and finally, the plasmid is delivered into the recombinant bacterium of Pseudomonas cepacia to obtain the super engineered bacterium of the Pseudomonas cepacia lipase. The method genetically modifies Pseudomonas cepacia G63, and the obtained super engineered bacterium has high expression and catalysis activity and good low-carbon alcohol tolerance and high-temperature resistance.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for constructing lipase genetically engineered bacteria. Background technique [0002] Today, when the energy crisis is intensifying, it is an extremely important and urgent task to find efficient and clean renewable energy, and it is undoubtedly the most effective and direct way to convert waste animal and vegetable oils into biodiesel. At present, there are mainly two kinds of biodiesel conversion methods: chemical method and enzymatic method. Among them, the chemical method has high energy consumption and high pollution; the enzymatic method has the advantages of mild reaction conditions and no pollution, and is an effective way to solve the energy crisis. [0003] In the process of enzymatic biodiesel preparation, the cost of lipase is the highest, which is one of the main bottlenecks restricting the further development of the process. The efficiency and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/52C12N15/55C12N15/56C12N15/63C12N15/78C12N1/21C12R1/38
Inventor 闫云君杨江科刘云贾彬徐莉
Owner HUAZHONG UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap