Test paper strip for rapidly detecting morbilli and rubella virus IgG antibody colloidal gold
A technology of measles virus and rubella virus, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of complex procedures, high detection cost, and long time, and achieve simple operation, clear and easy to distinguish results, and improved sensitivity and specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Cloning expression of embodiment 1 measles virus H, rubella virus E1 specific antigen
[0027] (1) Amplification of MV.H protein gene
[0028] MV genomic RNA was extracted according to the Trizol method, and then the first strand of cDNA was synthesized according to the instructions of the reverse transcription kit. (GenBank accession number of MV.H protein gene is AB045300)
[0029] Then use primers 5'CGCA AGCTTCTATCTGCGATTGGTTCCA 3' and 5'TTAGGATCCATGTCACCACA ACGAGACCG 3' under the action of high-fidelity DNA polymerase, at 95°C for 3min; 94°C for 30S, 54°C for 35s, 72105S, 30 cycles; then extend at 72°C The condition of 10min amplifies the MV.H gene. The product was purified by PCR Product (Mini) Purification Kit.
[0030] virus recombination
[0031] The MV.H gene and the vector pGEMEX-1 (Promega) were placed in the double enzyme digestion system of BamHI and Hind-III, respectively, in a water bath at 37°C for 1 h, and the product was recovered using a rubber ta...
Embodiment 2
[0050] Embodiment 2: measles, rubella virus IgG antibody colloidal gold rapid detection test strip (seeing Fig. 1)
[0051] (1) Preparation of colloidal gold-antibody conjugates:
[0052] It was determined by experiments that the optimum binding pH value of colloidal labeling of anti-human IgG monoclonal antibody was 8.0, and the ratio of colloidal gold and antibody was 20 μg / ml colloidal gold respectively. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.
[0053] (2) Coating antigen on nitrocellulose membrane:
[0054] The measles virus H antigen and rubella virus E1 antigen prepared in Example 1 were diluted to 3.5 mg / ml with 0.01 MPBS. Anti-mouse IgG polyclonal antibody was diluted to 2mg / ml with 0.01MPBS. Spray the two on the nitrocellulose memb...
Embodiment 3
[0061] Embodiment 3: method of use (see figure 2 )
[0062] Drop the sample to be tested (whole blood, plasma or serum) directly into the "4" of the test strip, and the sample solution goes up the membrane, and the result is interpreted within 10-15 minutes.
[0063] result:
[0064] If the sample contains measles virus and rubella virus IgG antibodies, it will form a corresponding complex with the colloidal gold-labeled anti-human IgG monoclonal antibody on the test strip, and go up with the measles virus H antigen and rubella virus coated on the nitrocellulose membrane. The combination of virus E1-specific antigens forms red lines, that is, red bands are formed at T1 and T2.
[0065] Regardless of whether it contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgG monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap