Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of dominant suppressing mutant F427D as anthrax bacillus toxin inhibitor and vaccine

A technology of Bacillus anthracis and anthrax toxin, applied in the direction of bacteria, bacterial peptides, antibacterial drugs, etc., can solve problems such as adverse reactions of the body, and achieve high biological safety and good immunogenicity

Inactive Publication Date: 2009-03-25
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the deficiency that the existing anthrax vaccine may combine with the polluted lethal factor or edema factor in the environment during emergency immunization to cause adverse reactions in the body, obtain a dominant inhibitory mutant F427D, and use the mutant as an anthrax vaccine. Application of Bacillus Toxin Inhibitors and Vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of dominant suppressing mutant F427D as anthrax bacillus toxin inhibitor and vaccine
  • Application of dominant suppressing mutant F427D as anthrax bacillus toxin inhibitor and vaccine
  • Application of dominant suppressing mutant F427D as anthrax bacillus toxin inhibitor and vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Cloning of the target gene

[0039] (1) Cloning of Bacillus anthracis protective antigen PA gene

[0040] 1. PCR primer design and synthesis

[0041] The upstream and downstream primers were designed according to the PA gene sequence reported in Genbank (Genbank accession number: No.AF065404). The upstream primer introduces the BamHI restriction site (as indicated by the underline in the primer), and designs 4 protective bases ACTA, and the downstream primer introduces the XhoI restriction site (as indicated by the underline in the primer), plus 4 protective bases GTAT. The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd.

[0042] PA upstream primer: 5'-ACTA GGATCC GAAGTTAAACAGGAGAACC-3'

[0043] PA downstream primer: 5'-GTAT CTCGAG CTATTATCCTATCTCATAGCCT-3'

[0044] 2. PA protein coding gene amplification and processing

[0045] Acapsulated anthrax sporelings (commercial microbial preparation, ...

Embodiment 2

[0058] Example 2 Site-directed saturation mutation of the 427th amino acid of the protective antigen PA and cloning of the mutant

[0059] 1. Site-directed saturation mutation of phenylalanine at position 427 of the Bacillus anthracis protective antigen PA gene into 19 other naturally occurring amino acids (1) Design and synthesis of PCR primers

[0060]According to the PA gene sequence in Genbank (Genbank accession number: No.AF065404), the upstream and downstream primers for site-directed saturation mutation of amino acid 427 of PA were designed. In the upstream and downstream primers, the codon TTC of phenylalanine was designed as a randomly synthesized base NNN (as indicated by the underline in the primer). The primers of the present invention were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd.

[0061] F427N upstream primer: 5`-CGCATTAAATGCACAAGACGAT NNN AGTTCTACTCC-3`; (N = A, T, G, C)

[0062] F427N downstream primer: 5`CATTGTAATTGGAGTAGAACT NN...

Embodiment 3

[0067] Example 3 Expression and purification of protein

[0068] (1) Cloning of Bacillus anthracis protective antigen PA gene and preparation method for expression and purification in recombinant Escherichia coli

[0069] 1. Construction of recombinant Escherichia coli BL21 / pGEX-KG-PA

[0070] Transform the recombinant expression vector pGEX-KG-PA with correct sequence identification into CaCl 2 Coli BL21 (DE3) (preserved by our laboratory) competent cells prepared by the method were spread on a plate, and a single positive colony (BL21 / pGEX-KG-PA) on the plate was selected and inserted into LB liquid medium for shaking culture at 37°C until (OD 600 =1.0), adding isopropylthio-β-D-galactoside (IPTG) to the medium to induce expression, and then carried out SDS-PAGE and Western-blot detection (Sambrook J, Fritsch EF, Mann Edited by Niartis T, Molecular Cloning Experiment Guide, translated by Jin Dongyan, Li Mengfeng, etc., second edition, Science Press, Beijing, 1992 edition)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of animal bacteriology and zoonosis science, particularly to an application of a dominant inhibitory mutant F427D as an inhibitor of Bacillus anthracis toxin and an application of vaccine thereof. The invention, through cloning of Bacillus anthracis lethal toxin gene, expression and purification of proteins, site-directed saturation mutagenesis of genes and the like, obtains protective antigen (namely the dominant inhibitory mutant F427D) of the Bacillus anthracis, the mutant is successfully cloned into pronucleus expression carrier pGEX-KG and composes recomposed plasmid pGEX-KG-PA (F427D). Escherichia coli containing the recomposed plasmid is nominated as Escherichia coli DH5Alpha / pGEX-KG-PA (F427D) and collected in the China Center for Type Culture Collection with a collection number of CCTCC-M208158. The invention further discloses the method for preparing the antigen protein, the preparation of anthrax toxin inhibitor and subunit vaccine by using the antigen protein and the application thereof.

Description

technical field [0001] The invention relates to the technical fields of animal bacteriology and zoonotic infectious diseases. It specifically relates to the application of a dominant suppressing mutant F427D as an anthracis bacillus toxin inhibitor and a vaccine. Background technique [0002] Anthrax is an acute, febrile, septic infectious disease caused by Bacillus anthracis. Characterized by sudden hyperthermia and death, cyanosis of visible mucosa, and coal tar-like blood from natural orifices. The OIE lists it as a Category B disease and a nationally notifiable disease. Bacillus anthracis is a long, thick, large bacterium of the aerobic Bacillus genus, without flagella, immobile, and Gram-positive. There are two forms of propagules and spores, and anthrax spores with strong resistance can be formed under sufficient oxygen and appropriate temperature. Because anthrax is easy to produce and prepare, its spore state can exist stably for a long time, it has strong resist...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C07K14/195A61K39/02A61P31/04C12R1/19
Inventor 郭爱珍曹莎陈焕春刘子铎张承才谭亚娣
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com