Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cold resistant correlated transcription factor gene of rice and uses thereof

A technology of transcription factors and cold resistance, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem of few CBF gene families in rice

Inactive Publication Date: 2009-05-13
YANGZHOU UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are still relatively few functional studies on the rice CBF gene family, and there are many unsolved problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cold resistant correlated transcription factor gene of rice and uses thereof
  • Cold resistant correlated transcription factor gene of rice and uses thereof
  • Cold resistant correlated transcription factor gene of rice and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Total synthesis of cold-responsive cis-element and construction of bait plasmid

[0034] Two identical cis-elements were concatenated using PCR. An Xho I restriction site is added to the 5' end of the tandem cis-elements, and a BamH I site is added to the 3' end. The length of the cis-element after concatenation is 107bp. The cis-element sequence is: ACCCTCGAGTCTAGAGTCGACATATGCCGCGGATATCTAGAGGCCGACCTGATGGCCGACCTGATGGCCGATCGATCCATGGCGGCCGCATGCATCCCGGGATCCTG. (SEQ ID NO.3)

[0035] Build strategies such as figure 1 , using pG221 as the starting plasmid, pG221 plasmid is transformed from the Escherichia coli-Saccharomyces cerevisiae shuttle plasmid pLGΔ-265UP1 with lacZ reporter gene, URA selection marker and 2u replication sequence, and the bacterial lacZ reporter gene is basically initiated by Saccharomyces cerevisiae Cycl As a bait, the DNA fragment of the cis-element is placed upstream of the basic promoter of Cycl to regulate the expression of the lacZ...

Embodiment 2

[0036] Example 2: Rice cDNA library construction.

[0037] 15-day-old rice seedlings, variety IR36, were treated at 0°C for 8 hours, quickly frozen in liquid nitrogen, and stored in a -70°C refrigerator for extraction of total RNA. The yeast expression vector plasmid pPC86 was purchased from Invitrogen Company; the cDNA library construction kit SMART cDNA library construction kit was a product of Clontech Company; the DNA column recovery kit was purchased from Amersham Company; total RNA was extracted using RNeasy Plant Mini Kit from QIAGEN Company; All restriction enzymes and T4 DNA ligase were purchased from Shanghai Takara Company.

[0038] Synthesis of rice cDNA and construction of cDNA library: The first strand was synthesized according to the instructions of Clontech's SMART cDNALibrary Construction Kit.

[0039] Using the first strand of the synthesized cDNA as a template, GAL4 5'AAAGTCGACGGATGTTTAATACCACT and TAD4 5'AAAGCGGCCGCTTGATTGGAGACTTGACC were used as primers t...

Embodiment 3

[0040] Example 3: Screening of cDNA binding protein with cold-responsive cis-element DNA in rice

[0041] The bait plasmid was transformed into yeast cell EGY48 (MATα, his3 trp1ura3-52leu::pLeu2-LexAop6), and the transformants were cultured on uracil-free minimal medium (Ito, et al. 1983; Gietz, et al. 2006).

[0042] Prepare yeast competent cells containing fish bait plasmids, transform 50 μg of pPC86 plasmid DNA containing rice cDNA library into competent yeast cells each time, and culture them on SC medium without uracil and tryptophan, so as to select the cells with Fish bait plasmid and yeast transformants of pPC86 plasmid inserted with rice cDNA. After culturing at 30°C for 48 hours, use a nitrocellulose membrane to copy the grown transformant onto a plate containing X-gal for color reaction (such as figure 2 , B in the figure shows that blue colonies appear after combination), pick blue yeast colonies.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of crop genetic breeding, and in particular relates to a gene related to rice cold tolerance and application thereof. The transcription factor gene related to the rice cold tolerance has a base sequence of SEQ ID NO.1. The transcription factor gene RCBF4 can be used for plant transformation so as to improve cold tolerance and hyperhaline resistance. The stress resistant gene originates from plant self, so the gene has smaller influence on environment.

Description

technical field [0001] The invention belongs to the field of crop genetics and breeding, and specifically relates to a gene related to cold tolerance of rice, and the application of the gene transformed into Arabidopsis thaliana to improve the cold tolerance of the plant. Background technique [0002] Drought, high salinity and low temperature are the most serious natural disasters for crops among many abiotic stresses, which have seriously affected crop yields and planting areas. According to statistics, the world's arid and semi-arid areas account for 33% of the earth's land area, and saline-alkali land accounts for 7.6% of the earth's land area. In addition, many areas are affected by low temperature and chilling damage all the year round. In my country, the area of ​​arid and semi-arid cultivated land is 570 million mu, accounting for 38% of the total cultivated land in the country. Drought and lack of rainfall lead to the death of a large number of vegetation, weatheri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H1/00
Inventor 陈建民姚泉洪熊爱生张扬彭日荷洪义欢
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com