Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for real time quantitative PCR detection of mitotic cycle protein B2 gene expression

A cell cycle, quantitative detection technology, applied in the field of medical oncology, to achieve high specificity and sensitivity, wide application effect

Active Publication Date: 2013-07-10
BEIJING ACCB BIOTECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Arsenic trioxide (As2O3) is a carcinogen that can promote cell proliferation and induce tumorigenesis, but there is uncertainty in the extrapolation of dose effects in vitro
[0009] At present, the technology of detecting tumor markers from blood is not perfect, and there are many problems. First, the detection methods are not uniform, including the detection technology and tumor markers adopted by various companies. Inconsistent, it is difficult to compare the research results with each other: second, the sensitivity is low, and some patients may be missed; third, most tumor marker genes have "illegitimate expression" in normal white blood cells, such as using RT-PCR Detection of CK-19mRNA may appear "false positive" in peripheral blood of some healthy people(10)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for real time quantitative PCR detection of mitotic cycle protein B2 gene expression
  • Method for real time quantitative PCR detection of mitotic cycle protein B2 gene expression
  • Method for real time quantitative PCR detection of mitotic cycle protein B2 gene expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1: real-time quantitative PCR detection technology

[0048] 1.1 Materials and methods

[0049] Normal serum samples were obtained from the physical examination of new recruits at the Beijing Military General Hospital, and serum samples from patients with various tumors were mainly obtained from Chengde North Hospital and Baoding Hengxing Hospital of Integrated Traditional Chinese and Western Medicine. Trizol RNA extraction kit was purchased from In Vitrogen Shanghai Shenneng Biotechnology Co., Ltd. RevertAidT' first-strand cDNA synthesis kit was purchased from Promege. PCR primers and probes were synthesized by Dalian Bao Biotechnology Co., Ltd. Fluorescent quantitative PCR kit was purchased from Dalian Bao Biological Engineering Company. Quantitative PCR instrument is FB-2000 (Shanghai Fengling Biotechnology Company)

[0050] Cyc B2-8 SEQ ID NO: 18 5'AGCTGCTTCCTGCTTGTCTC3' SEQ ID NO: 19 5'GCACAATGAAGCACACATCC3' Cyc B2-9...

Embodiment 2

[0064] Fluorescent quantitative PCR method was used to detect serum 18S rRNA and cyclin B2 transcripts in cancer detection, the Ct value of each reaction tube was measured, and the relative amount of cyclin B2 in the sample was calculated and analyzed by delta Ct method (Fig. 1 Shown is the average value of the relative expression levels obtained from the detection of 10 different types of cancers listed in Table 2).

[0065] The primers and probes listed in Table 3 were used to detect the various samples in Table 2, respectively.

[0066] The total error between different experiments is 5%. In all serum samples examined from 10 types of cancer (see Table 2), cyclin B2 was found to be significantly overexpressed compared to normal samples.

Embodiment 3

[0068] Application of real-time quantitative PCR to detect serum 18S rRNA and cyclin B2 transcripts in treatment-treated patients

[0069] To examine whether real-time PCR detection of serum expression levels of cyclin B2 can be used to monitor cancer treatment treatments (eg, surgery, chemotherapy, radiotherapy, etc.), and to monitor the efficacy of cancer recurrence after treatment. Serum cyclin B2 expression levels were compared as described above before and after cancer therapy treatment (Fig. 2). Serum cyclin B2 levels were found to be significantly lower in patients of the above-mentioned 10 cancers after treatment (eg surgery) (mean ± standard deviation shown in Figure 2).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method and a kit for quantitative detection of the expression of cyclin B2 gene in blood samples, especially in serum.

Description

technical field [0001] The present invention relates to the field of medical oncology. Specifically, the present invention relates to a new method for detecting the expression of cyclin B2 gene in blood, especially serum, and its kit. Background technique [0002] Malignant tumor is an important disease that threatens human health. At present, at least 7 million people die of malignant tumor every year in the world, of which about 1.3 million are in my country. Malignant tumor has become the second cause of human death due to disease after cardiovascular and cerebrovascular diseases. More than 90% of malignant tumors belong to solid tumors of epithelial origin (commonly known as cancer, such as lung cancer, liver cancer, gastric cancer, etc.), and the main cause of death of these malignant solid tumors (hereinafter referred to as tumors) is metastasis, especially systemic metastasis. It has been observed clinically that for patients with early-stage tumors without lymph no...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q2600/158C12Q1/6851C12Q1/6886
Inventor 董晓明
Owner BEIJING ACCB BIOTECH