Method for real time quantitative PCR detection of mitotic cycle protein B2 gene expression
A cell cycle, quantitative detection technology, applied in the field of medical oncology, to achieve high specificity and sensitivity, wide application effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1: real-time quantitative PCR detection technology
[0048] 1.1 Materials and methods
[0049] Normal serum samples were obtained from the physical examination of new recruits at the Beijing Military General Hospital, and serum samples from patients with various tumors were mainly obtained from Chengde North Hospital and Baoding Hengxing Hospital of Integrated Traditional Chinese and Western Medicine. Trizol RNA extraction kit was purchased from In Vitrogen Shanghai Shenneng Biotechnology Co., Ltd. RevertAidT' first-strand cDNA synthesis kit was purchased from Promege. PCR primers and probes were synthesized by Dalian Bao Biotechnology Co., Ltd. Fluorescent quantitative PCR kit was purchased from Dalian Bao Biological Engineering Company. Quantitative PCR instrument is FB-2000 (Shanghai Fengling Biotechnology Company)
[0050] Cyc B2-8 SEQ ID NO: 18 5'AGCTGCTTCCTGCTTGTCTC3' SEQ ID NO: 19 5'GCACAATGAAGCACACATCC3' Cyc B2-9...
Embodiment 2
[0064] Fluorescent quantitative PCR method was used to detect serum 18S rRNA and cyclin B2 transcripts in cancer detection, the Ct value of each reaction tube was measured, and the relative amount of cyclin B2 in the sample was calculated and analyzed by delta Ct method (Fig. 1 Shown is the average value of the relative expression levels obtained from the detection of 10 different types of cancers listed in Table 2).
[0065] The primers and probes listed in Table 3 were used to detect the various samples in Table 2, respectively.
[0066] The total error between different experiments is 5%. In all serum samples examined from 10 types of cancer (see Table 2), cyclin B2 was found to be significantly overexpressed compared to normal samples.
Embodiment 3
[0068] Application of real-time quantitative PCR to detect serum 18S rRNA and cyclin B2 transcripts in treatment-treated patients
[0069] To examine whether real-time PCR detection of serum expression levels of cyclin B2 can be used to monitor cancer treatment treatments (eg, surgery, chemotherapy, radiotherapy, etc.), and to monitor the efficacy of cancer recurrence after treatment. Serum cyclin B2 expression levels were compared as described above before and after cancer therapy treatment (Fig. 2). Serum cyclin B2 levels were found to be significantly lower in patients of the above-mentioned 10 cancers after treatment (eg surgery) (mean ± standard deviation shown in Figure 2).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


