Unlock instant, AI-driven research and patent intelligence for your innovation.

Multiple quantitative RT-PCR gene expression spectrum analysis method based on fluorescent universal primer

A technology of gene expression profiling and universal primers, which is applied in the field of multiple quantitative RT-PCR gene expression profiling analysis based on fluorescent universal primers, can solve the problems of low detection throughput, time-consuming and labor-intensive sample processing, etc., to reduce complexity and improve Effect of improving reaction efficiency and amplification efficiency

Inactive Publication Date: 2009-06-24
DONGHUA UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Real-time qPCR technology has been proved to have the advantages of good stability, high sensitivity and quantitative linearity of 7 orders of magnitude, but it also has the disadvantages of low detection throughput, time-consuming, labor-intensive and high cost of sample processing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple quantitative RT-PCR gene expression spectrum analysis method based on fluorescent universal primer
  • Multiple quantitative RT-PCR gene expression spectrum analysis method based on fluorescent universal primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Primer sequence design of universal primers and upstream and downstream chimeric specific primers

[0028] experiment procedure:

[0029] (1) Design of universal primers: According to the rice sequence information in GenBank database, two 20bp long sequences were designed as universal primers. The design principle is to ensure that the primers have no product bands in the PCR reaction on the mouse genome, and avoid non-specific products brought by universal primers. The theoretical annealing temperature of the universal primer was controlled at 55°C. The 5' end of the upstream universal primer was fluorescently labeled with Fam. The universal primer sequences are Fam-cgggctacgctatctacgac (upstream) and cgggcagtaagtaccgttgt (downstream).

[0030] (2) Design of upstream and downstream chimeric specific primers: According to the cDNA sequence information of 11 mouse target genes and 3 housekeeping genes in the GenBank database, 14 pairs of 18bp long sequences were de...

Embodiment 2

[0045] Expression analysis of candidate genes for sexual development initiation in 15-day-old mouse testis tissue of 2 strains——upstream chimeric-specific primer touchdown PCR combined with fluorescent universal primer addition optimization method

[0046] experiment procedure:

[0047] (1) The mice were dissected to get the testis tissue, and the total RNA of the tissue was extracted with TRIzol Reagent (Invitrogen). A small amount of DNA contamination mixed with TRIzol-extracted total RNA was digested with DNase I.

[0048] (2) The cDNA single-stranded template of the target gene is synthesized by reverse transcription with specific downstream primers. The reverse transcription reaction system is 5×Reaction Buffer 4μL, MgCl 2 (25mM) 4.8μL, dNTP Mix (2mM) 1μL, ImProm-II Reverse Transcriptase (Promega) 1μL, downstream chimeric primer (total concentration 10μM) 2μL, RNA template (100ng / μL) 2-3μL, replenish water to 20μL. The reaction process was 5 minutes at 25°C, 60 minutes...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for analyzing a multi-quantitative RT-PCR gene expression profile based on a fluorescence universal primer. The method comprises the steps as follows: (1) the primer sequence of the universal primer, an upstream chimeric specific primer and a downstream chimeric specific primer is designed as follow: the length of the universal primer is 20bp, the 5' end of an upstream universal primer is marked by Fam fluorescence, the length of the chimeric specific primer is 38bp, the 3' end is a specific primer sequence section, and the 5' end is a universal primer sequence section; (2) multiple RT-PCR reaction process is carried out; and (3) analysis and detection are carried out by sequencer gel electrophoresis. The invention is suitable for studying the expression analysis of specific candidate gene of specific drug metabolic pathway or signal conduction path and the like in 10-30 genes / reactions, and the invention is the best and simple multiple solving proposal towards quantitative, high-flux and economic gene expression analysis.

Description

technical field [0001] The invention relates to the field of biotechnology gene expression analysis, in particular to a multiple quantitative RT-PCR gene expression profile analysis method based on fluorescent universal primers. Background technique [0002] With the development of modern molecular biology techniques and related detection instruments, gene expression profiling has also developed rapidly. Gene expression profiling plays a vital role in analyzing gene functions, determining transcriptional regulatory pathways, elucidating signal transduction or metabolic pathways, and studying expression level polymorphisms, and provides information for molecular medicine, disease diagnosis and treatment. got help. [0003] The study of human complex trait diseases and the mapping of related genes are current research hotspots. The genetic mechanisms and associated effector genes for diseases such as diabetes, cancer, Alzheimer's disease, and schizophrenia remain largely unk...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 王勤熙李凯赵丽亚周宇荀肖君华
Owner DONGHUA UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More