Multiple quantitative RT-PCR gene expression spectrum analysis method based on fluorescent universal primer
A technology of gene expression profiling and universal primers, which is applied in the field of multiple quantitative RT-PCR gene expression profiling analysis based on fluorescent universal primers, can solve the problems of low detection throughput, time-consuming and labor-intensive sample processing, etc., to reduce complexity and improve Effect of improving reaction efficiency and amplification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] 1. Primer sequence design of universal primers and upstream and downstream chimeric specific primers
[0028] experiment procedure:
[0029] (1) Design of universal primers: According to the rice sequence information in GenBank database, two 20bp long sequences were designed as universal primers. The design principle is to ensure that the primers have no product bands in the PCR reaction on the mouse genome, and avoid non-specific products brought by universal primers. The theoretical annealing temperature of the universal primer was controlled at 55°C. The 5' end of the upstream universal primer was fluorescently labeled with Fam. The universal primer sequences are Fam-cgggctacgctatctacgac (upstream) and cgggcagtaagtaccgttgt (downstream).
[0030] (2) Design of upstream and downstream chimeric specific primers: According to the cDNA sequence information of 11 mouse target genes and 3 housekeeping genes in the GenBank database, 14 pairs of 18bp long sequences were de...
Embodiment 2
[0045] Expression analysis of candidate genes for sexual development initiation in 15-day-old mouse testis tissue of 2 strains——upstream chimeric-specific primer touchdown PCR combined with fluorescent universal primer addition optimization method
[0046] experiment procedure:
[0047] (1) The mice were dissected to get the testis tissue, and the total RNA of the tissue was extracted with TRIzol Reagent (Invitrogen). A small amount of DNA contamination mixed with TRIzol-extracted total RNA was digested with DNase I.
[0048] (2) The cDNA single-stranded template of the target gene is synthesized by reverse transcription with specific downstream primers. The reverse transcription reaction system is 5×Reaction Buffer 4μL, MgCl 2 (25mM) 4.8μL, dNTP Mix (2mM) 1μL, ImProm-II Reverse Transcriptase (Promega) 1μL, downstream chimeric primer (total concentration 10μM) 2μL, RNA template (100ng / μL) 2-3μL, replenish water to 20μL. The reaction process was 5 minutes at 25°C, 60 minutes...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap