Expression production and separation purification of recombinant placenta growth factor and chemical marker thereof

A placental growth factor, biotin labeling technology, applied in the field of biotechnology-recombinant genetic engineering, can solve the problems of low expression, high price and high cost of culture medium

Active Publication Date: 2009-08-05
ACROIMMUNE BIOTECH CO LTD
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, mammalian cells such as CHO cells are used to express and produce recombinant proteins, and the expression level is generally low, and the medium for cultivating such cells is expensive and expensive, so it is not suitable for large-scale industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression production and separation purification of recombinant placenta growth factor and chemical marker thereof
  • Expression production and separation purification of recombinant placenta growth factor and chemical marker thereof
  • Expression production and separation purification of recombinant placenta growth factor and chemical marker thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Example 1: Construction of PLGF expression vector.

[0087] 1.1 PCR amplification of human PLGF gene

[0088] The primers for PCR amplification of human PLGF gene are as follows:

[0089] Forward upstream primer (PLGF-F): ggattc GAA TTC gccttgtctgctgggaacggc

[0090] Reverse downstream primer (PLGF-R): ggattc GC GGCC GC gccgggtgcggggtctctctc

[0091] PCR amplification system:

[0092]

[0093]

[0094] PCR amplification conditions: 94°C for 5 minutes / 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 40 seconds, a total of 20 cycles.

[0095] After the PCR amplification of the gene was completed, a small amount was taken and analyzed by agarose gel electrophoresis. There was an amplified band at about 400 bp, and the fragment size was consistent with the expected PLGF131 gene fragment.

[0096] 1.2 Construction and identification of PLGF-pPic9K plasmid

[0097] The PCR amplified fragment and the pPic9K plasmid were double digested with EcoR I and Not I r...

Embodiment 2

[0098] Example 2: Expression Vector Transformation of GS115 Host Bacteria and Induced Expression of PLGF Protein

[0099] 2.1 The pPic9-PLGF1 plasmid was prepared in 100ml of bacterial liquid by alkaline lysis-PEG purification. For specific steps, refer to the relevant chapters of "Molecular Cloning III".

[0100] 2.2 Take two tubes of about 15ug pPic9-PLGF1 plasmid and linearize them thoroughly with 30U Sal I and 30U Bgl II respectively. After digestion, the plasmid was precipitated with ethanol and redissolved with 5ul ultrapure sterile deionized water.

[0101] 2.3 Preparation of GS115 Competent Cells

[0102] (1) Inoculate a single clone in 3ml YPD medium and culture overnight at 30°C

[0103] (2) Put 300ul of the above-mentioned fresh bacterial solution in 300ml YPD medium at 30°C

[0104] Incubate for 18 hours. At this time, the OD value is about 1.3.

[0105] (3) Bacteria were collected by centrifugation at 1500 g for 5 minutes, and then resuspended with 300 ml of...

Embodiment 3

[0128] Example 3: SDS-PAGE detection and analysis of recombinant PLGF protein secreted and expressed by yeast cells

[0129]SDS-PAGE and ELISA methods were used to detect, analyze and identify the recombinant PLGF protein secreted and expressed in the yeast cell supernatant. After 48-96 hours of induced expression in the transformed GS115 yeast host, the supernatant was collected and loaded (reduced with DTT, or unreduced without DTT) to 12% SDS-PAGE gel electrophoresis for analysis. After the electrophoresis, the PAGE gel was stained with silver to visualize the protein, and the results were as follows: figure 2 Shown: Compared with the negative control yeast supernatant (swimming lanes 1 and 3), the pPic9-PLGF1 transformed yeast supernatant sample has a specificity of about 20-25KD under the condition of adding DTT reduction (swimming lane 4) protein band, which is consistent with the molecular weight of the predicted recombinant PLGF protein monomer; while in the unreduce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biological technique, i.e. gene recombination engineering. Placental growth factors (PLGFs) play important roles in neovascularization and vascular proliferation; however, natural PLGF content in vivo is low and the natural PLGFs have short half-times, thus to extract sufficient entogenous PLGF proteins so as to satisfy the increasingly demands of experimental study and clinical practice is difficult. The invention discloses a method for efficiently expressing, producing and recombining a PLGF system in vitro by gene recombination engineering and cell culture technology and for extracting and purifying the PLGF proteins from expressed supernatant by chromatographic separating technology. The invention also discloses a nonradioactive chemical coupling labeling treatment method for the purified PLGF proteins in vitro. The PLGF proteins (including the unlabeled or the chemical coupling labeled) have wide application in the experimental study and the clinical practice.

Description

technical field [0001] The invention belongs to the field of biotechnology-recombinant genetic engineering, and relates to the expression and production of biologically active recombinant placental growth factor (placental growth factor, PLGF) by genetic engineering and eukaryotic cell fermentation and culture technology. The invention also relates to the separation and purification of the recombinant PLGF protein, its chemical labeling in vitro and its application. Background technique: [0002] Angiogenesis or angiogenesis refers to the process in which blood vessels (such as capillaries and venules) in the body produce new blood vessels by sprouting or dividing. Angiogenesis is beneficial and necessary to maintain many normal physiological processes of the body, such as tissue embryonic development, wound healing and repair. However, excessive angiogenesis or hyperplasia is also closely related to many pathological changes (such as tumor proliferation, inflammatory respo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/81C07K14/475C07K1/13G01N33/68
Inventor周群敏周青罗师平胡红群徐一清
OwnerACROIMMUNE BIOTECH CO LTD