Fusion protein for resisting formation of thrombus targetedly and preparation method and application thereof

A fusion protein and antithrombotic technology, applied in the field of fusion protein, can solve problems such as single function, short biological half-life, strong bleeding side effects, etc., and achieve the effects of enhancing curative effect, reducing blood lipid, and improving kidney function

Inactive Publication Date: 2009-08-26
CHONGQING UNIV
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its effect is obviously better than that of heparin, and there is no heparin-induced thrombocytopenia, but its biological half-life is short, its bleeding side effects are strong, and its function is single. sex

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein for resisting formation of thrombus targetedly and preparation method and application thereof
  • Fusion protein for resisting formation of thrombus targetedly and preparation method and application thereof
  • Fusion protein for resisting formation of thrombus targetedly and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0050] Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. The experimental method that does not indicate specific conditions in the preferred embodiment is usually according to conventional conditions, such as described in the Molecular Cloning Experiment Guide (Third Edition, J. Sambrook et al., translated by Huang Peitang, etc., Science Press, 2002) conditions, or as recommended by the manufacturer.

[0051] 1. Preparation of fusion protein gene

[0052] According to the amino acid sequence of the fusion protein (SEQ ID NO.4), the codon preference of Pichia pastoris and the characteristics of the multiple cloning site on the Pichia pastoris expression vector pPIC9K, the following polymerase chain reaction (PCR) primer P1 was designed and synthesized ~P8 (SEQ ID NO.6~13):

[0053] P1: 5′-cg gaattc catcatcatcatcatcatcatgatgatgatgataagcaa agaccagctaagaag -3'

[0054] P2: 5′- ccacaatcatcca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fusion protein for resisting formation of thrombus targetedly, which comprises the following parts: (a) protein domains of nematode anticoagulant peptide 5, of which the amino acid sequence has at least 80 percent of similarity with a sequence shown as SEQ ID No.1; (b)protein domains of Hirulog, of which the amino acid sequence has at least 80 percent of similarity with a sequence shown as SEQ ID No.2; (c) protein domains of RGD peptide, consisting of 3 to 10 amino acids and containing an Arg-Gly-Asp sequence; and (d) human coagulation factor X a recognition sites, of which the amino acid sequence is shown as SEQ ID No.3. The invention also discloses a gene encoding the fusion protein, a recombined expression vector containing the gene, a transformant containing the recombined expression vector, and a method for preparing the fusion protein. The prepared fusion protein can inhibit formation and development of thrombus from a plurality of approaches and take effect on thrombus positions targetedly, and is suitable for preventing and treating thrombotic disorders.

Description

technical field [0001] The present invention relates to a fusion protein, in particular to a targeted anti-thrombosis fusion protein, and to a preparation method and application of the fusion protein. Background technique [0002] Under physiological conditions, the hemostatic and coagulation system in the human body is in a state of dynamic balance with the anticoagulant and fibrinolytic system, which is the key to maintaining blood circulation in the body and preventing blood loss. Any abnormality in the functioning of one of these systems can lead to a bleeding disorder or a thrombotic disorder. Thrombotic diseases include venous thrombosis and arterial thrombotic diseases, such as deep venous thrombosis, acute myocardial infarction, unstable angina, acute or chronic intravascular coagulation, thrombocytopenia caused by heparin, reembolization after thrombolysis, etc., serious harm Human life and health have become the main cause of human death and disability, as well as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N15/81C12N1/19C12N1/21C12N5/10A61K38/16A61P7/02
Inventor 陈国平梁岩胡宗利李勇胡功铃王达菲王炳琴
Owner CHONGQING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap