Fusion protein for resisting formation of thrombus targetedly and preparation method and application thereof
A fusion protein and antithrombotic technology, applied in the field of fusion protein, can solve problems such as single function, short biological half-life, strong bleeding side effects, etc., and achieve the effects of enhancing curative effect, reducing blood lipid, and improving kidney function
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0050] Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings. The experimental method that does not indicate specific conditions in the preferred embodiment is usually according to conventional conditions, such as described in the Molecular Cloning Experiment Guide (Third Edition, J. Sambrook et al., translated by Huang Peitang, etc., Science Press, 2002) conditions, or as recommended by the manufacturer.
[0051] 1. Preparation of fusion protein gene
[0052] According to the amino acid sequence of the fusion protein (SEQ ID NO.4), the codon preference of Pichia pastoris and the characteristics of the multiple cloning site on the Pichia pastoris expression vector pPIC9K, the following polymerase chain reaction (PCR) primer P1 was designed and synthesized ~P8 (SEQ ID NO.6~13):
[0053] P1: 5′-cg gaattc catcatcatcatcatcatcatgatgatgatgataagcaa agaccagctaagaag -3'
[0054] P2: 5′- ccacaatcatcca...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com