Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same

A chromosome and chip technology, applied in the field of chromosome detection, can solve the problems of high requirements and time-consuming

Inactive Publication Date: 2009-10-21
BEIJING GP MEDICAL TECH
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although karyotype analysis is still the most reliable method for diagnosing chromosomal diseases so far, it is difficult to routinely carry out in general laboratories due to the high requirements of cell culture technology and time-consuming during prenatal diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same
  • Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same
  • Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Preparation of sensor chip

[0036] (1) Preparation of biomarker probe sensor chip

[0037] 1. Glucan modification of sensor chip

[0038] a). Cleaning of bare gold pieces

[0039] First use a strong oxidizer (H 2 SO 4 :H 2 O 2 ) Or plasma etching method to clean the bare gold chip, then clean the surface with ultrapure water and degassed ethanol, and then dry it with a stream of pure nitrogen.

[0040] b). Preparation of self-assembled monolayers (SAMs)

[0041] The formation of self-assembled monolayers (SAMs) of single or mixed components of mercapto hydrocarbons on a clean gold surface has been widely used in the modification of chemical or biological sensor chips.

[0042] The process of preparing SAMs on the gold surface is as follows: immerse the clean bare gold sheet in an ethanol solution containing 1-10 mM sulfhydryl hydrocarbon compounds, and incubate for 12-18 hr at room temperature.

[0043] There are 3 simple methods for the synthesis of mixed monol...

Embodiment 2

[0059] Example 2: Sample detection process (21 trisomy detection)

[0060] 1. Reaction sample preparation

[0061] 1.1 Sample DNA extraction

[0062] Genomic DNA is extracted from blood or amniotic fluid cells, and a certain amount of DNA template is used for the next step of quantitative amplification reaction.

[0063] 1.2 PCR amplification

[0064] In order to obtain sufficient detection signals, it is necessary to amplify nucleic acid tags specific to the chromosome to be tested. The present invention uses an asymmetric PCR method to amplify the sample to obtain a single-stranded product. The 50ul PCR reaction system includes 10mM Tris-HCL (pH8.3), 50mM KCl, 1.0-5.0mM MgCl 2 , 100-500uM dNTP, 0.5-5u / ul DNA polymerase, 0.01-5.0uM primer, 300ng DNA template and other necessary components.

[0065]First, common primers are used to initially amplify the genome to produce a certain amount of double strands. Common primers for nucleic acid tag amplification of chromosome 1 are: CTCA...

Embodiment 3

[0084] Embodiment 3: Sample detection process (X chromosome detection)

[0085] 1. Reaction sample preparation

[0086] 1.1 Sample DNA extraction

[0087] Same as Example 2

[0088] 1.2 PCR amplification

[0089] Except for primers and probes, everything else is the same as in Example 2. The common primers required for the amplification of the X chromosome nucleic acid tag are: TTCGTTTCAGGCCTTGGTACTAT (forward primer), CAAACCCCCTACCTGTAATGTCA (reverse primer). The extension primer is, GGCTGGTGCGTCCAAACCCCCTACCTGTAATGTCA, and the probe is, TTTGAGATACAGAAATAGGACAGAT

[0090] 1.3 Preparation of sample solution

[0091] Same as Example 2

[0092] 2. Perform hybridization detection on SPR instrument

[0093] Same as the second embodiment.

[0094] 3. Interpretation of results

[0095] Detect the recorded signal value (see Table 2), the calculation method of the record chart is:

[0096] Total hybridization signal (hybridization) = RU after hybridization-RU before loading

[0097] Speci...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting a chromosome by a surface plasmon resonance (SPR) technology. Aiming at the normal chromosomal abnormality (dysploid) of a fetus and a new born child, a probe of the specificity of the chromosom is designed to quantitatively detect a nucleic acid label of the specificity of the chromosom, therefore, the copy number of the chromosom is confirmed. The invention also improves an enveloped technology and a detected technology of an SPR biological sensing chip and makes the detection of the copy number abnormality of the chromosom by clinically applying the SPR technology possible. The copy number abnormality of the chromosom can be rapidly detected by applying the method and the biological sensing chip, and the method can be used for prenatal diagnosis, good birth and good care and improves population quality.

Description

Invention field [0001] The invention belongs to the field of chromosome detection. Specifically, it relates to a method for detecting chromosomal genes using Surface Plasmon Resonance (SPR) technology. The present invention also relates to an improved SPR biosensor chip used in the above method, and a kit containing the chip and a nucleic acid probe. Background technique [0002] Surface Plasmon Resonance Technology (SPR) is a technology that uses physical and optical phenomena caused by total reflection of light at the metal film / liquid surface interface to analyze the interaction between molecules. The SPR instrument consists of an automatic sampling manipulator, a high-resolution CCD camera, and a gold- or silver-plated SPR biosensor chip with one or more flow cells on it. SPR technology has been widely used in the detection and analysis of interactions between biological molecules. [0003] SPR technology uses surface plasma waves that can be excited on the interface of certa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/55C12Q1/68G01N33/68
Inventor 陈忠刘宁陈永军袁新清
Owner BEIJING GP MEDICAL TECH