Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same
A chromosome and chip technology, applied in the field of chromosome detection, can solve the problems of high requirements and time-consuming
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Preparation of sensor chip
[0036] (1) Preparation of biomarker probe sensor chip
[0037] 1. Glucan modification of sensor chip
[0038] a). Cleaning of bare gold pieces
[0039] First use a strong oxidizer (H 2 SO 4 :H 2 O 2 ) Or plasma etching method to clean the bare gold chip, then clean the surface with ultrapure water and degassed ethanol, and then dry it with a stream of pure nitrogen.
[0040] b). Preparation of self-assembled monolayers (SAMs)
[0041] The formation of self-assembled monolayers (SAMs) of single or mixed components of mercapto hydrocarbons on a clean gold surface has been widely used in the modification of chemical or biological sensor chips.
[0042] The process of preparing SAMs on the gold surface is as follows: immerse the clean bare gold sheet in an ethanol solution containing 1-10 mM sulfhydryl hydrocarbon compounds, and incubate for 12-18 hr at room temperature.
[0043] There are 3 simple methods for the synthesis of mixed monol...
Embodiment 2
[0059] Example 2: Sample detection process (21 trisomy detection)
[0060] 1. Reaction sample preparation
[0061] 1.1 Sample DNA extraction
[0062] Genomic DNA is extracted from blood or amniotic fluid cells, and a certain amount of DNA template is used for the next step of quantitative amplification reaction.
[0063] 1.2 PCR amplification
[0064] In order to obtain sufficient detection signals, it is necessary to amplify nucleic acid tags specific to the chromosome to be tested. The present invention uses an asymmetric PCR method to amplify the sample to obtain a single-stranded product. The 50ul PCR reaction system includes 10mM Tris-HCL (pH8.3), 50mM KCl, 1.0-5.0mM MgCl 2 , 100-500uM dNTP, 0.5-5u / ul DNA polymerase, 0.01-5.0uM primer, 300ng DNA template and other necessary components.
[0065]First, common primers are used to initially amplify the genome to produce a certain amount of double strands. Common primers for nucleic acid tag amplification of chromosome 1 are: CTCA...
Embodiment 3
[0084] Embodiment 3: Sample detection process (X chromosome detection)
[0085] 1. Reaction sample preparation
[0086] 1.1 Sample DNA extraction
[0087] Same as Example 2
[0088] 1.2 PCR amplification
[0089] Except for primers and probes, everything else is the same as in Example 2. The common primers required for the amplification of the X chromosome nucleic acid tag are: TTCGTTTCAGGCCTTGGTACTAT (forward primer), CAAACCCCCTACCTGTAATGTCA (reverse primer). The extension primer is, GGCTGGTGCGTCCAAACCCCCTACCTGTAATGTCA, and the probe is, TTTGAGATACAGAAATAGGACAGAT
[0090] 1.3 Preparation of sample solution
[0091] Same as Example 2
[0092] 2. Perform hybridization detection on SPR instrument
[0093] Same as the second embodiment.
[0094] 3. Interpretation of results
[0095] Detect the recorded signal value (see Table 2), the calculation method of the record chart is:
[0096] Total hybridization signal (hybridization) = RU after hybridization-RU before loading
[0097] Speci...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 