Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same

A chromosome and chip technology, applied in the field of chromosome detection, can solve the problems of high requirements and time-consuming

Inactive Publication Date: 2011-09-21
BEIJING GP MEDICAL TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although karyotype analysis is still the most reliable method for diagnosing chromosomal diseases so far, it is difficult to routinely carry out in general laboratories due to the high requirements of cell culture technology and time-consuming during prenatal diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same
  • Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same
  • Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment one: the preparation of sensor chip

[0036] (1) Preparation of biomarker probe sensor chip

[0037] 1. Dextran modification of the sensor chip

[0038] a). Cleaning of bare gold sheet

[0039] First, a strong oxidizing agent (H 2 SO 4 :H 2 o 2 ) or plasma etching to clean the bare gold sheet, then clean the surface with ultrapure water and degassed ethanol, and then dry it with pure nitrogen flow.

[0040] b). Preparation of self-assembled monolayers (SAMs)

[0041] The formation of self-assembled monolayers (SAMs) of single or mixed components of thiol hydrocarbons on clean gold surfaces has been widely used in the modification of chemical or biological sensing chips.

[0042] The process of preparing SAMs on the gold surface is as follows: immerse a clean bare gold sheet in an ethanol solution containing 1-10 mM mercapto hydrocarbon compound, and incubate at room temperature for 12-18 hours.

[0043] There are 3 convenient methods for the synthesis...

Embodiment 2

[0059] Embodiment 2: Sample detection process (trisomy 21 detection)

[0060] 1. Reaction Sample Preparation

[0061] 1.1 Sample DNA extraction

[0062] Genomic DNA is extracted from blood or amniotic fluid cells, and a certain amount of DNA template is used for the next quantitative amplification reaction.

[0063] 1.2PCR amplification

[0064] In order to obtain sufficient detection signals, it is necessary to amplify the nucleic acid tag specific to the chromosome to be tested. The present invention uses the asymmetric PCR method to amplify the sample to obtain a single-stranded product, and the 50ul PCR reaction system includes 10mM Tris-HCL (pH8.3), 50mM KCl, 1.0-5.0mM MgCl 2 , 100-500uM dNTP, 0.5-5u / ul DNA polymerase, 0.01-5.0uM primer, 300ng DNA template and other necessary components.

[0065]First, common primers are used to initially amplify the genome to generate a certain amount of double strands. Common primers for nucleic acid tag amplification of chromosome...

Embodiment 3

[0084] Embodiment 3: Sample detection process (X chromosome detection)

[0085] 1. Reaction Sample Preparation

[0086] 1.1 Sample DNA extraction

[0087] Same as Example 2

[0088] 1.2PCR amplification

[0089] Except for primers and probes, others are the same as Example 2. Common primers required for X chromosome nucleic acid tag amplification are: TTCGTTTCAGGCCTTGGTACTAT (forward primer), CAAACCCCCTACCTGTAATGTCA (reverse primer) extended primer is, GGCTGGTGCGTCCAAACCCCCTACCTGTAATGTCA, probe is, TTTGAGATACAGAAATAGGACAGAT

[0090] 1.3 Sample solution preparation

[0091] Same as Example 2

[0092] 2. Perform hybridization detection on the SPR instrument

[0093] Same as embodiment two.

[0094] 3. Interpretation of results

[0095] Detect the recorded signal value (see Table 2), and the calculation method of the record chart is:

[0096] Total hybridization signal (hybridization) = RU after hybridization - RU before loading

[0097] Specific hybridization signal (w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for detecting a chromosome by a surface plasmon resonance (SPR) technology. Aiming at the normal chromosomal abnormality (dysploid) of a fetus and a new born child, a probe of the specificity of the chromosom is designed to quantitatively detect a nucleic acid label of the specificity of the chromosom, therefore, the copy number of the chromosom is confirmed. The invention also improves an enveloped technology and a detected technology of an SPR biological sensing chip and makes the detection of the copy number abnormality of the chromosom by clinically applyingthe SPR technology possible. The copy number abnormality of the chromosom can be rapidly detected by applying the method and the biological sensing chip, and the method can be used for prenatal diagnosis, good birth and good care and improves population quality.

Description

field of invention [0001] The invention belongs to the field of chromosome detection. Specifically, it relates to a method for detecting chromosomal genes using surface plasmon resonance (Surface Plasmon Resonance, SPR). The present invention also relates to an improved SPR biosensor chip used in the above method, and a kit comprising the chip and nucleic acid probes. Background technique [0002] Surface Plasmon Resonance (SPR) is a technology that uses the physical optics phenomenon caused by the total reflection of light at the metal film / liquid interface to analyze the interaction between molecules. The SPR instrument consists of an automatic sampling manipulator, a high-resolution CCD camera, and a gold-plated or silver-plated SPR biosensor chip with one or more flow cells on it. SPR technology has been widely used in the detection and analysis of the interaction between biomolecules. [0003] SPR technology utilizes surface plasmon waves that can be excited on the i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/55
Inventor 陈忠刘宁陈永军袁新清
Owner BEIJING GP MEDICAL TECH