Method for detecting chromosome by surface plasmon resonance (SPR) technology and chip used by same
A chromosome and chip technology, applied in the field of chromosome detection, can solve the problems of high requirements and time-consuming
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment one: the preparation of sensor chip
[0036] (1) Preparation of biomarker probe sensor chip
[0037] 1. Dextran modification of the sensor chip
[0038] a). Cleaning of bare gold sheet
[0039] First, a strong oxidizing agent (H 2 SO 4 :H 2 o 2 ) or plasma etching to clean the bare gold sheet, then clean the surface with ultrapure water and degassed ethanol, and then dry it with pure nitrogen flow.
[0040] b). Preparation of self-assembled monolayers (SAMs)
[0041] The formation of self-assembled monolayers (SAMs) of single or mixed components of thiol hydrocarbons on clean gold surfaces has been widely used in the modification of chemical or biological sensing chips.
[0042] The process of preparing SAMs on the gold surface is as follows: immerse a clean bare gold sheet in an ethanol solution containing 1-10 mM mercapto hydrocarbon compound, and incubate at room temperature for 12-18 hours.
[0043] There are 3 convenient methods for the synthesis...
Embodiment 2
[0059] Embodiment 2: Sample detection process (trisomy 21 detection)
[0060] 1. Reaction Sample Preparation
[0061] 1.1 Sample DNA extraction
[0062] Genomic DNA is extracted from blood or amniotic fluid cells, and a certain amount of DNA template is used for the next quantitative amplification reaction.
[0063] 1.2PCR amplification
[0064] In order to obtain sufficient detection signals, it is necessary to amplify the nucleic acid tag specific to the chromosome to be tested. The present invention uses the asymmetric PCR method to amplify the sample to obtain a single-stranded product, and the 50ul PCR reaction system includes 10mM Tris-HCL (pH8.3), 50mM KCl, 1.0-5.0mM MgCl 2 , 100-500uM dNTP, 0.5-5u / ul DNA polymerase, 0.01-5.0uM primer, 300ng DNA template and other necessary components.
[0065]First, common primers are used to initially amplify the genome to generate a certain amount of double strands. Common primers for nucleic acid tag amplification of chromosome...
Embodiment 3
[0084] Embodiment 3: Sample detection process (X chromosome detection)
[0085] 1. Reaction Sample Preparation
[0086] 1.1 Sample DNA extraction
[0087] Same as Example 2
[0088] 1.2PCR amplification
[0089] Except for primers and probes, others are the same as Example 2. Common primers required for X chromosome nucleic acid tag amplification are: TTCGTTTCAGGCCTTGGTACTAT (forward primer), CAAACCCCCTACCTGTAATGTCA (reverse primer) extended primer is, GGCTGGTGCGTCCAAACCCCCTACCTGTAATGTCA, probe is, TTTGAGATACAGAAATAGGACAGAT
[0090] 1.3 Sample solution preparation
[0091] Same as Example 2
[0092] 2. Perform hybridization detection on the SPR instrument
[0093] Same as embodiment two.
[0094] 3. Interpretation of results
[0095] Detect the recorded signal value (see Table 2), and the calculation method of the record chart is:
[0096] Total hybridization signal (hybridization) = RU after hybridization - RU before loading
[0097] Specific hybridization signal (w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 