3-sterone-9alpha-hydroxylation enzyme gene, 3-sterone-9alpha-hydroxylation enzyme reductase gene, relevant carriers, engineering bacteria and applications thereof

A technology of hydroxylase reductase and hydroxylase, applied in the direction of genetic engineering, oxidoreductase, application, etc., can solve problems such as restricting the development of steroid medicine industry and high production cost of steroid medicine

Active Publication Date: 2009-10-28
EAST CHINA UNIV OF SCI & TECH
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] As a bottleneck link in the production system of steroid medicine industry, some microbial transformation reactions seriously restrict the rapid development of steroid medicine industry, and it is also an important reason for the high production cost of steroid medicine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 3-sterone-9alpha-hydroxylation enzyme gene, 3-sterone-9alpha-hydroxylation enzyme reductase gene, relevant carriers, engineering bacteria and applications thereof
  • 3-sterone-9alpha-hydroxylation enzyme gene, 3-sterone-9alpha-hydroxylation enzyme reductase gene, relevant carriers, engineering bacteria and applications thereof
  • 3-sterone-9alpha-hydroxylation enzyme gene, 3-sterone-9alpha-hydroxylation enzyme reductase gene, relevant carriers, engineering bacteria and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Acquisition of 3-sterone-9α-hydroxylase gene (KSH)

[0069] The inventor screened a steroid-degrading strain by himself, which was identified as Mycobacterium, named Mycobacterium neoaurum NwIB-01, and the preservation number was CCTCC M 209094. In this example, the whole gene sequence of 3-sterone-9α-hydroxylase was cloned from this strain by PCR method.

[0070] 1.1 Obtaining the conserved sequence of 3-sterone-9α-hydroxylase gene

[0071] The following four strains of mycobacteria were compared by gene homology (data from NCBI, see the sequence number below):

[0072] ·Mycobacterium avium 104(gb|CP000479.1|)

[0073] ·Mycobacterium vanbaalenii PYR-1(gb|CP000511.1|)

[0074] ·Mycobacterium gilvum_PYR-GCK(gb|CP000656.1|)

[0075] ·Mycobacterium smegmatis str.MC2 155(gb|CP000480.1|)

[0076] The conserved sequence of 3-sterone 9α-hydroxylase in Mycobacterium was obtained, the software Oligo 6.0 and Primer 5.0 were used to design degenerate primers, an...

Embodiment 2

[0100] Example 2 Construction of Escherichia coli genetically engineered bacteria overexpressing 3-sterone-9α-hydroxylase

[0101] 2.1 Cloning of gene 3-sterone 9α-hydroxylase

[0102] According to the full-length gene sequence of 3-sterone 9α-hydroxylase (M.S-KSH), the amplification primers KSH-Q and KSH-H were designed and synthesized, and their sequences are as follows:

[0103] KSH-Q: 5'-CGC CCATGG CCGTGACTACCGAGACAG-3';

[0104] KSH-H: 5'-CG AAGCTT TCAGCTCGGCTGCGCGGACT-3'.

[0105] Among them, the Nco I restriction site was introduced into the primer KSH-Q, and the Hind III restriction site was introduced into the primer KSH-H.

[0106] The total DNA of the wild strains screened was used as a template, and primers KSH-Q and KSH-H were used as a primer pair for PCR amplification, and the specific conditions were as follows:

[0107] Reaction system: Tag enzyme 1 μl, buffer 5 μl, template 1 μl, dNTP 4 μl, upstream and downstream primers 1 μl, pure water 33 μl.

...

Embodiment 3

[0117] Example 3 Overexpression and integrated expression of 3-sterone-9α-hydroxylase gene in mycobacteria

[0118] Reintroduction of the 3-sterone 9α-hydroxylase gene into mycobacteria using the pAL5000 and pFZ2 mycobacterium-E. coli shuttle expression vectors to enable 3-sterone-9α-hydroxylase in the original mycobacterial species Gene overexpression.

[0119] The primer sequences used are as follows:

[0120] U: CGGGGATCCGTGACTACCGAGACAG

[0121] D: GGCAAGCTTTCAGCTCGGCTGCGCGGACT

[0122] The annealing condition of the PCR reaction system was optimized and determined to be 56.5°C for 90s. The 1.2kb KSH gene was cloned from mycobacteria, and was recovered and connected with the vector pMD19-T to construct a recombinant cloning plasmid, which was verified by sequencing. The cloning vector was double-digested with restriction endonucleases BamHI and HindIII, recovered and inserted into the mycobacterium-Escherichia coli shuttle expression plasmids pAL5000 and pFZ2 that ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a 3-sterone-9Alpha-hydroxylation enzyme gene and a 3-sterone-9Alpha-hydroxylation enzyme reductase gene. By constructing various expression vectors and converting relevant strains, the invention obtains various high-expression strains such as escherichia coli, streptomyces and mycobacterium; furthermore, the mycobacterium of the 3-sterone-9Alpha-hydroxylation enzyme activity can be prepared; the prepared high-expression strains or other crude enzyme liquid can be used for catalyzing and producing the 3-sterone-9Alpha-hydroxylation steroid compounds; the mycobacterium of the 3-sterone-9Alpha-hydroxylation enzyme activity can be used for degrading sterol to prepare androst-4-alkene-3, 17-diketone or androst-1, 4-diene-3, 17-diketone; the engineering stains can greatly improve the production efficiency and product quality of the steroid drugs, are beneficial for reducing the energy consumption of steroid drugs during the production process, improving the utilization ratio of the prodrugs and simplifying the production steps, reduce the production cost, have moderate reaction conditions and friendly environment, are suitable for wide generalization and application and have higher economic benefits and social benefits.

Description

technical field [0001] The present invention relates to the technical field of molecular biology, more specifically, to the technical field of 3-sterone-9α-hydroxylase and its reductase, in particular to a 3-sterone-9α-hydroxylase gene, a 3-sterone-9α-hydroxylase reductase gene, related vectors, engineering bacteria and applications. Background technique [0002] Steroids, also known as steroids, are a class of compounds with cyclopentane polyhydrophenanthrene as the core and similar structures. Its basic structure is shown below. It consists of three six-membered rings and one five-membered ring, which are called A, B, C, and D rings. There may be a hydroxyl group, a keto group or an alkyl group at the 17th position, and the A, B, C and D rings may have double bonds, and there are often side chains of different lengths at the 17th position. A series of compounds with unique physiological functions are formed due to the differences in substituents, double bond positions or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/63C12N1/21C12P33/06C12N1/20C12R1/32C12R1/325C12R1/33C12R1/34C12R1/19C12R1/465
Inventor魏东芝王风清魏巍范书玥姚抗
OwnerEAST CHINA UNIV OF SCI & TECH