3-sterone-9alpha-hydroxylation enzyme gene, 3-sterone-9alpha-hydroxylation enzyme reductase gene, relevant carriers, engineering bacteria and applications thereof
A technology of hydroxylase reductase and hydroxylase, applied in the direction of genetic engineering, oxidoreductase, application, etc., can solve problems such as restricting the development of steroid medicine industry and high production cost of steroid medicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1 Acquisition of 3-sterone-9α-hydroxylase gene (KSH)
[0069] The inventor screened a steroid-degrading strain by himself, which was identified as Mycobacterium, named Mycobacterium neoaurum NwIB-01, and the preservation number was CCTCC M 209094. In this example, the whole gene sequence of 3-sterone-9α-hydroxylase was cloned from this strain by PCR method.
[0070] 1.1 Obtaining the conserved sequence of 3-sterone-9α-hydroxylase gene
[0071] The following four strains of mycobacteria were compared by gene homology (data from NCBI, see the sequence number below):
[0072] ·Mycobacterium avium 104(gb|CP000479.1|)
[0073] ·Mycobacterium vanbaalenii PYR-1(gb|CP000511.1|)
[0074] ·Mycobacterium gilvum_PYR-GCK(gb|CP000656.1|)
[0075] ·Mycobacterium smegmatis str.MC2 155(gb|CP000480.1|)
[0076] The conserved sequence of 3-sterone 9α-hydroxylase in Mycobacterium was obtained, the software Oligo 6.0 and Primer 5.0 were used to design degenerate primers, an...
Embodiment 2
[0100] Example 2 Construction of Escherichia coli genetically engineered bacteria overexpressing 3-sterone-9α-hydroxylase
[0101] 2.1 Cloning of gene 3-sterone 9α-hydroxylase
[0102] According to the full-length gene sequence of 3-sterone 9α-hydroxylase (M.S-KSH), the amplification primers KSH-Q and KSH-H were designed and synthesized, and their sequences are as follows:
[0103] KSH-Q: 5'-CGC CCATGG CCGTGACTACCGAGACAG-3';
[0104] KSH-H: 5'-CG AAGCTT TCAGCTCGGCTGCGCGGACT-3'.
[0105] Among them, the Nco I restriction site was introduced into the primer KSH-Q, and the Hind III restriction site was introduced into the primer KSH-H.
[0106] The total DNA of the wild strains screened was used as a template, and primers KSH-Q and KSH-H were used as a primer pair for PCR amplification, and the specific conditions were as follows:
[0107] Reaction system: Tag enzyme 1 μl, buffer 5 μl, template 1 μl, dNTP 4 μl, upstream and downstream primers 1 μl, pure water 33 μl.
...
Embodiment 3
[0117] Example 3 Overexpression and integrated expression of 3-sterone-9α-hydroxylase gene in mycobacteria
[0118] Reintroduction of the 3-sterone 9α-hydroxylase gene into mycobacteria using the pAL5000 and pFZ2 mycobacterium-E. coli shuttle expression vectors to enable 3-sterone-9α-hydroxylase in the original mycobacterial species Gene overexpression.
[0119] The primer sequences used are as follows:
[0120] U: CGGGGATCCGTGACTACCGAGACAG
[0121] D: GGCAAGCTTTCAGCTCGGCTGCGCGGACT
[0122] The annealing condition of the PCR reaction system was optimized and determined to be 56.5°C for 90s. The 1.2kb KSH gene was cloned from mycobacteria, and was recovered and connected with the vector pMD19-T to construct a recombinant cloning plasmid, which was verified by sequencing. The cloning vector was double-digested with restriction endonucleases BamHI and HindIII, recovered and inserted into the mycobacterium-Escherichia coli shuttle expression plasmids pAL5000 and pFZ2 that ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com