Method for excreting and expressing recombinant human granulocyte-colony factor in colon bacillus

A granulocyte and colony technology, applied in the direction of recombinant DNA technology, chemical instruments and methods, botany equipment and methods, etc., can solve the problem that foreign proteins cannot be glycosylated, affect the formation of correct conformation, and are unfavorable for large-scale cultivation and purification And other issues

Inactive Publication Date: 2009-12-02
BEIJING SL PHARMA
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the prokaryotic expression system also has some disadvantages: for example, foreign proteins cannot be glycosylated and easy to form inclusion bodies, etc.
However, the intracellular soluble expression method also has obvious disadvantages: the intracellular environment is a reducing environment, which is not conducive to the formation of correct disulfide bond bridges for foreign proteins, which in turn affects the formation of the correct conformation, and requires ultrasonic or pressure crushing Only the cell wall can release the soluble expression components in the cell, which is not conducive to large-scale culture and purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for excreting and expressing recombinant human granulocyte-colony factor in colon bacillus
  • Method for excreting and expressing recombinant human granulocyte-colony factor in colon bacillus
  • Method for excreting and expressing recombinant human granulocyte-colony factor in colon bacillus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] The sequence of λPL promoter and PCR primers for synthesis are cloned from Escherichia coli vector pBLV by PCR method, and PCR amplification is carried out using it as a template. The upstream primer used was: 5'GTGAATTCAGATCTCTCACCTACCAAAC3' (containing EcoRI), and the downstream primer was: 5'GTCATATGACTAGTCCTCCTTAATTTTTAACCAATG 3' (containing the Spel site). After the PCR product was digested by EcoRI / Spel double enzymes, it was recovered by low-melting gel dispensing for future use.

Embodiment 2

[0023] The human GCSF gene is already available in our company. The designed primers are obtained by PCR from the original preserved plasmid. Two extension primers are designed upstream. Primer 1: 5'-GGT TTA GTT TTA GCG TTT AGC GCA TCG GCGACACCATTAGGCCCTGCCAGC-3', Primer 2: 5 '-GAGGAATTCATG AAA AAG ATT TGG CTGGCG CTG GCT GGT TTA GTT TTA GCG TTT AGC-3' downstream primer 5'-GCGGGATCCTCACGGCTGGGCAAG-3', the amplified fragment is about 600bp in length. The second GCA at the 5' end is connected to the coding DNA of the last amino acid of the DsbA signal peptide, so that the first amino acid of the human GCSF mature protein is (Thr), so the amino terminal of GCSF secreted after the signal peptide is excised does not contain Met, And consistent with natural GCSF. The amino acid sequence of the signal peptide is: Met Lys Lys Ile Trp Leu Ala Leu Ala Gly Leu Val Leu Ala Phe Ser Ala SerAla

Embodiment 3

[0025] Construction of pBV-DsbA-GCSF plasmid

[0026] In this example, a plasmid was constructed containing the DsbA-GCSF sequence and the rmB termination sequence. The rmB sequence was provided by plasmid pBv220, a known expression plasmid. The heterologous protein sequence to be expressed in this plasmid is placed downstream of the PRPL promoter, which allows expression of the protein sequence located downstream of it when heat induced. Plasmid pBV220 was double cut with BamHI / SaLI to form plasmid pBV-DsbA-GCSF. The structure of the PBV-DsbA-GCSF plasmid is as follows figure 2 As shown, immediately downstream of the DsbA-GCSF sequence is the rrnB termination sequence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for the excretive expression of a recombinant human granulocyte-colony factor (rHG-CSF) in colon bacillus. In the invention, a carrier of periplasmic cavity excretive type expression recombinant proteins can be established by adding DsbA signal peptide (SEQ ID NO:1) at the N end of an exogenous protein and using an lambadaPL promoter, the DH5alpha competent cells of the colon bacillus are converted, and the expression of the exogenous protein in the periplasmic cavity of the colon bacillus is realized by temperature induction. The method has high expression quantity and high excreting efficiency, and is suitable for effectively and stably excreting and expressing various exogenous genes.

Description

technical field [0001] The present invention relates to a method for secreting expression of recombinant human granulocyte colony factor (G-CSF) in the periplasmic cavity of E. : 1)), and a novel expression vector for exogenous protein expression in the periplasmic cavity of Escherichia coli; description and application of this expression vector. technical background [0002] Genetically engineered recombinant human granulocyte colony-stimulating factor (rhG-CSF) is mainly used for neutropenia after chemotherapy in cancer patients. In addition, it is also used for bone marrow transplantation, certain types of leukemia, AIDS leukopenia and aplastic Anemia, etc., have shown significant curative effect. At present, most of them are expressed by Escherichia coli. Although the expression level is high, inclusion bodies are formed, and the active protein needs to be denatured and refolded to obtain the active protein. The yield is very low, and the N-terminal methionine cannot be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/27C12N15/70C07K14/535C12P21/02
Inventor梁果义王俊玲刘迎连治国杨仲璠张鹏吴彦卓徐明波
OwnerBEIJING SL PHARMA