Unlock instant, AI-driven research and patent intelligence for your innovation.

Metarginase and recombination expression method and use thereof

A technology of arginine deiminase and expression method, applied in the field of pharmacology of biologically active proteins and their cross-links

Inactive Publication Date: 2010-08-04
GUANGZHOU HUAYIN MEDICINE SCI & TECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the comprehensive optimization of the lysine site on the arginine deiminase by gene recombination to improve its cross-linking effect with polyethylene glycol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Metarginase and recombination expression method and use thereof
  • Metarginase and recombination expression method and use thereof
  • Metarginase and recombination expression method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Recombinant expression of arginine deiminase

[0064] (1) Design and synthesis of 13 DNA templates of arginine deiminase:

[0065] DNA template 1:

[0066] 5'-ATGTCTGTATTTGACAGTAAATTTAAGGGAATTCATGTCTATTCAGAAATTGGTGAACTAGAAACCGTTTTAGTTCACGAACCTGGTAAAGAAATTGATTACATTACCCCAGCTCGT-3';

[0067] DNA template 2:

[0068] 5'-TAATTCAACTTCATTAATTCCACGCTTTTTAAGTTCTGCTACGAATTCTTTGTGTTCTTTTCTTGCATCGTGGCTTTCTAGAATTGCTGAGAATAATAATTCATCGAAACGAGCTGGGGTAATGTA-3';

[0069] DNA template 3:

[0070] 5'-ATTAATGTTGTTGAATTAGTAGATCTAATCGTAGAAACCTATGATTTAGCATCAAAAGAAGCTAAAGAAAAACTTTTAGAAGAATTCCTAGATGATTCAGTACCAGTT-3';

[0071] DNA template 4:

[0072] 5'-TTTTAAATCGTGTTTAGTGATCCCTGCGATCATGTATTCAACTAATTTACGAGAAGTTTTTTTAGCTTTTAAGAAATTACGAACAGTAGCTTTGTGAGCTTCTGATAGAACTGGTACTGAATCATC-3';

[0073] DNA template 5:

[0074] 5'-ACTAAACACGATTTAAAAATCGAATCAGATTTAGAATTAATCGTTGACCCAATGCCTAACTTGTACTTCACTCGTGACCATTTGCATCAGTAGGTAATGGAGTTACCATCCAC-3';

[0075] DNA template 6:

[0076] 5'-GTACC...

Embodiment 2

[0108] Example 2: Determination of Arginine Deiminase Activity

[0109] The activity of arginine deiminase is determined by the amount of citrulline produced by catalyzing arginine (see Evelyn L. Oginsky: Methods Enzymology 3 (1957): 639-643), a unit of arginine Deiminase activity was defined as the conversion of 1 micromol arginine to citrulline at 37°C.

[0110] First use citrulline samples with a concentration of 1-10mM to measure the light absorption value at a wavelength of 490nm, and make a standard curve equation as y=-0.099+0.129x, and the linear correlation coefficient is R 2 =0.99, standard curve such as image 3 shown. Mix 5 microliters of the solution to be tested with 5 microliters of 20mM arginine substrate, and react at 37°C for 15 minutes; butanedione-oxime solution), after reacting at 80 DEG C for 30 minutes, read the light absorption value reading of 490 wavelength; according to the standard curve equation of citrulline, draw arginine deiminase and activat...

Embodiment 3

[0111] Example 3: Preparation of arginine deiminase of the present invention and succinimidylcarbonate (succinimidylcarbonate, SC) polyethylene glycol cross-linked product

[0112] In terms of molar concentration, carry out cross-linking with 50 times of succinimide carbonate polyethylene glycol (molecular weight 12000, purchased from Laysan Bio Company) and the arginine deiminase obtained in Example 1: the succinimide Add amine carbonate polyethylene glycol at a concentration of 125 mg per ml, and arginine deiminase at a concentration of 10 mg per ml to 0.1M sodium phosphate buffer (pH 8.0), and mix and react at 4°C for 60 minutes Add the reaction product to the Superdex 200 chromatographic column and elute with 50mM sodium phosphate buffer (pH6.5) containing 150mM sodium chloride to obtain arginine deiminase and succinimide carbonate poly Glycol cross-linked product. As determined by the method of Example 2, the cross-linked product of arginine deiminase and succinimide car...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an optimized metarginase cross linked with polyethylene glycol for gene recombination and application thereof. Compared with the existing metarginase, the lysine locus is uniformly distributed on the molecular surface of metarginase which is cross-linked with the polyethylene glycol. The gene of recombined metarginase is obtained by amplifying chain polymerase reaction with the designed DNA as the template and then cloned with plasmid and converted to the recipient cell to express. The cross-linked products of the purified recombined metarginase and polyethylene glycol can be applied to curing a plurality of cancers associated with arginine which is not combined by itself. The gene recombined metarginase and the cross-linked product thereof disclosed by the invention have better effect of prohibiting growth of cancer cell and lower immunogenicity compared with the existing metarginase and cross-linked product.

Description

technical field [0001] The invention belongs to the field of pharmacology of biologically active proteins and their cross-linked products, in particular to an arginine deiminase recombinantly expressed for optimal cross-linking with polyethylene glycol and its application. Background technique [0002] Arginine is a nutrient that plays an important role in the process of cell division, but it is a non-essential amino acid for the human body. In the presence of nitrogen, normal cells can rely on arginylsuccinate synthetase to pass citrulline Synthetic arginine. However, some cancer cells cannot synthesize arginine by themselves because they lack the gene of arginylsuccinate synthetase, so they can only survive by relying on foreign arginine cells. That said, arginine is an essential amino acid for some cancer cells. Therefore, any enzyme that can decompose and deplete exogenous arginine, such as arginine deiminase (arginine deiminase), can cause cancer cells to die due to t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/80C12N15/70A61K38/50A61K47/48A61P35/00A61P35/02C12N11/08C12R1/19A61K47/60
Inventor 李川江
Owner GUANGZHOU HUAYIN MEDICINE SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More