Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof

A technology of recombinant vectors and genetically engineered bacteria, applied in the field of genetic engineering, to achieve the effects of preventing and controlling plant diseases and insect pests, promoting plant growth, and increasing plant yield

Inactive Publication Date: 2010-08-25

无锡亚克生物科技有限公司

1 Cites 7 Cited by

AI-Extracted Technical Summary

Problems solved by technology

The research and development of Harpin protein is hailed as a green chemical revolution in plant production and food safety, and Bacillus subtilis is currently one of the only several microbial pesticides that can be used in the production of green vegetables A and AA, combining the two It is nec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Abstract

The invention discloses a recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof. An encoding gene of the Harpin protein is cloned into an expression vector so as to establish a bacillus subtilis recombinant vector pGAprEHS for expressing the Harpin protein; the bacillus subtilis recombinant vector pGAprEHS is then recombined into an alkaline proteolytic enzyme aprE gene locus on a bacillus subtilis chromosome to obtain intermediate engineering bacteria; an nprE gene locus mutation vector pUNprEK is then converted into the intermediate engineering bacteria so as to knock another intermediate proteolytic enzyme nprE gene out and establish bacillus subtilis gene engineering bacteria FZB42/ANHSK which is deficient of two proteolytic enzymes and used for expressing the Harpin protein; and finally, an antibiotic screening mark is removed from the engineering bacteria by means of a Cre/lox recombinant enzyme system to obtain the engineering bacteria which are safer and more friendly to environment, people and livestock.

Application Domain

Plant growth regulatorsBiocide +7

Technology Topic

ProteolysisProteolytic enzymes +9

Image

Examples

Experimental program(6)

Example Embodiment

Example 1: Construction of Bacillus subtilis Harpin protein expression vector pGAprEHS

(1) Using the genome of Bacillus subtilis FZB42 as a template, use primers aprE-1 and aprE-2 to amplify 2815bp of aprE gene and its flanking sequence. The amplification program is: 95℃, 4min; 94℃, 45s; 55 ℃, 30s; 72℃, 2min; 30 cycles; 72℃, 10min; ligate the amplified fragment with the pGEM-T-esay cloning vector to successfully construct pGEM-easy-T-aprE.

aprE-1 ATAGTAAGGGCAGCATCAACC

aprE-2 CGGTCGTGATTGATCCTTTATA

(2) Using the Bacillus subtilis-E. coli Harpin protein shuttle expression vector pM43HF plasmid designed by our laboratory as a template, primers P43-1 (HapI) and Hrp-2 (ClaI) amplify the p43+SP+hrf2 gene sequence, The size is 813bp, and the amplification program is: 95°C, 4min; 94°C, 45s; 62°C, 30s; 72°C, 1min; 30 cycles; 72°C, 10min; the amplified fragments are double cut by HapI and ClaI After connecting with the pGEM-T-esay-aprE vector, the pGEM-easy-T-aprE-p43sphrf2 intermediate vector was successfully constructed.

P43-1(HapI)AACTGATAGGTGGTATGTTTTC

Hrp-2(ClaI)TTTTATCGATCTATTACTGCATTGATGCGC

(3) Using the plasmid pIC333 as a template, use primers spe-1-lox66 and primers spe-2-lox71 to amplify the antibiotic (spectinomycin) marker gene sequence containing lox sequence locus, the amplification program is: 95℃, 4min; 94℃, 30s; 62℃, 30s; 72℃, 2min; 30 cycles; 72℃, 10min; the size of the amplified loxspec encoding gene fragment is 1438bp;

spe-1-lox66: TACCGTTCGTATAATGTATGCTATACGAAGTTATGCTCAGTGGAACGAAAACTCACG;

spe-2-lox71: TACCGTTCGTATAGCATACATTATACGAAGTTATAAGGTGGATACACATCTTGTCA;

The antibiotic screening gene amplified by the Pfu enzyme was connected to the intermediate vector pGEM-easy-T-aprE-p43sphrf2 cut with HpaI restriction enzyme in a blunt-ended manner, and the recombinant vector pGAprEHS expressing Harpin protein was successfully constructed (Figure 1).

Example Embodiment

Example 2: Construction of Bacillus subtilis FZB42 nprE gene site-directed mutagenesis vector pUNprEK:

(1) Using plasmid pBT2-arcA as the donor vector of the antibiotic lox-km sequence, digest with pstI restriction enzyme, recover the lox-km fragment, connect it with the common cloning vector pUC18, and successfully construct the intermediate vector pUK;

(2) Using the genome of Bacillus subtilis FZB42 as a template, the primers nrpE-L1-blunt (EheI) and nrpE-L2 (sphI) were used to amplify the nprE gene part and its left sequence totaling 1492bp. The amplification program is: 95 ℃, 4min; 94℃, 45s; 62℃, 30s; 72℃, 2min; 30 cycles; 72℃, 10min; ligate the amplified fragments with the pUK intermediate cloning vector, and successfully construct pUKN-L.

nrpE-L1-blunt(EheI): TCACTGTTGTCTGAATCCCTTG

nrpE-L2(sphI): AAAAAGCATGCACCTAAACCCACAATAAATCCC

(3) Using the genome of Bacillus subtilis FZB42 as a template, primers nrpE2274R1 (SalI) and nrpE3662R2 (KpnI) were used to amplify the nprE gene part and its right sequence totaling 1388 bp. The amplification program was: 95℃, 4min; 94℃ , 45s; 62℃, 30s; 72℃, 2min; 30 cycles; 72℃, 10min; double cut the amplified fragments SalI and KpnI and ligate them with the pUKN-L intermediate cloning vector, and successfully construct the Bacillus subtilis FZB42 nprE gene Site-directed mutagenesis vector pUNprEK.

nprE2274R1(SalI): AATCGTCGACCTCGCCTATGATGTAAC

nprE3662R2(KpnI): AAGGTACCATGTACAATGGAACATGGC

Example Embodiment

Example 3: Construction of Bacillus subtilis non-antibiotic marker genetically engineered strain FZB42/ANH expressing Harpin protein

The genetically transformable strain Bacillus subtilis FZB42, which is excellent in growth promotion and biocontrol, was selected as the starting strain of the engineering bacteria, and the Harpin protein expression vector pGAprEHS of Example 1 was transferred into the FZB42 strain by the chemically competent transformation method to obtain the intermediate engineering bacteria FZB42/AHS; Next, the nprE gene site-directed mutagenesis vector pUNprEK of Example 2 was transformed into the intermediate engineering strain FZB42/AHS to construct the engineered strain FZB42/ANHSK expressing Harpin protein; finally, the vector pBR1-Cre capable of expressing the recombinase protein Cre It was transferred into the engineered strain FZB42/ANHSK, and the antibiotic marker gene was cut out, and the target engineering strain was successfully constructed, the Bacillus subtilis gene engineering strain FZB42/ANH that expresses Harpin protein without antibiotic marker. Stored at -70°C in Landy medium containing 30% glycerol.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

Classification and recommendation of technical efficacy words

Conducive to accumulation
Environmentally friendly

Winter-planting oat forage grass high-yield interplanting mode cultivation method

InactiveCN109526613ANutritious timeConducive to accumulationCereal cultivationCultivating equipmentsPastureSowing

Owner:SICHUAN AGRI UNIV

Breeding soil for stimulating movement of eupolyphaga

InactiveCN109744203AIncrease activityConducive to accumulationAnimal husbandryRiver sandPerlite

Owner:DANYANG CITY HUANGTANG TOWN JIANGSHU TIANYI TUYUAN SPECIALIZED COOP

People also interested in

Promote plant growth Mutation Expression vector Chromosome Protein C Bacillus subtilis Bacteria Microorganism based processes Fungicides Disinfectants Animal repellants Insecticides

Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof

A technology of recombinant vectors and genetically engineered bacteria, applied in the field of genetic engineering, to achieve the effects of preventing and controlling plant diseases and insect pests, promoting plant growth, and increasing plant yield

AI-Extracted Technical Summary

Problems solved by technology

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Winter-planting oat forage grass high-yield interplanting mode cultivation method

Breeding soil for stimulating movement of eupolyphaga

White latex adhesive agent for packaging paper product and method of producing the same

Preparation method of porous hollow carbon microsphere co-doped with oxygen and nitrogen

Silicoaluminophosphate molecular sieve catalyst, preparation method, and use thereof

Classification and recommendation of technical efficacy words

Winter-planting oat forage grass high-yield interplanting mode cultivation method

Breeding soil for stimulating movement of eupolyphaga

Novel foamer composition and methods for making and using same

Method and composition for metal finishing

One-step preparation method and application of supported platinum-based multi-metal catalysts

Method for recovering valued metals from waste lithium cobaltate batteries

Method for preparing fluoroethylene carbonate

People also interested in