Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof

A technology of recombinant vectors and genetically engineered bacteria, applied in the field of genetic engineering, to achieve the effects of preventing and controlling plant diseases and insect pests, promoting plant growth, and increasing plant yield

Inactive Publication Date: 2010-08-25
无锡亚克生物科技有限公司
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research and development of Harpin protein is hailed as a green chemical revolution in plant production and food safety, and Bacillus subtilis is currently one of the only several microbial pesticides that can be used in the production of green vegetables A and AA, combining the two It is nec

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof
  • Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof
  • Recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

Example 1: Construction of Bacillus subtilis Harpin protein expression vector pGAprEHS

(1) Using the genome of Bacillus subtilis FZB42 as a template, use primers aprE-1 and aprE-2 to amplify 2815bp of aprE gene and its flanking sequence. The amplification program is: 95℃, 4min; 94℃, 45s; 55 ℃, 30s; 72℃, 2min; 30 cycles; 72℃, 10min; ligate the amplified fragment with the pGEM-T-esay cloning vector to successfully construct pGEM-easy-T-aprE.

aprE-1 ATAGTAAGGGCAGCATCAACC

aprE-2 CGGTCGTGATTGATCCTTTATA

(2) Using the Bacillus subtilis-E. coli Harpin protein shuttle expression vector pM43HF plasmid designed by our laboratory as a template, primers P43-1 (HapI) and Hrp-2 (ClaI) amplify the p43+SP+hrf2 gene sequence, The size is 813bp, and the amplification program is: 95°C, 4min; 94°C, 45s; 62°C, 30s; 72°C, 1min; 30 cycles; 72°C, 10min; the amplified fragments are double cut by HapI and ClaI After connecting with the pGEM-T-esay-aprE vector, the pGEM-easy-T-aprE-p43sphrf2 intermedia...

Example Embodiment

Example 2: Construction of Bacillus subtilis FZB42 nprE gene site-directed mutagenesis vector pUNprEK:

(1) Using plasmid pBT2-arcA as the donor vector of the antibiotic lox-km sequence, digest with pstI restriction enzyme, recover the lox-km fragment, connect it with the common cloning vector pUC18, and successfully construct the intermediate vector pUK;

(2) Using the genome of Bacillus subtilis FZB42 as a template, the primers nrpE-L1-blunt (EheI) and nrpE-L2 (sphI) were used to amplify the nprE gene part and its left sequence totaling 1492bp. The amplification program is: 95 ℃, 4min; 94℃, 45s; 62℃, 30s; 72℃, 2min; 30 cycles; 72℃, 10min; ligate the amplified fragments with the pUK intermediate cloning vector, and successfully construct pUKN-L.

nrpE-L1-blunt(EheI): TCACTGTTGTCTGAATCCCTTG

nrpE-L2(sphI): AAAAAGCATGCACCTAAACCCACAATAAATCCC

(3) Using the genome of Bacillus subtilis FZB42 as a template, primers nrpE2274R1 (SalI) and nrpE3662R2 (KpnI) were used to amplify the nprE g...

Example Embodiment

Example 3: Construction of Bacillus subtilis non-antibiotic marker genetically engineered strain FZB42 / ANH expressing Harpin protein

The genetically transformable strain Bacillus subtilis FZB42, which is excellent in growth promotion and biocontrol, was selected as the starting strain of the engineering bacteria, and the Harpin protein expression vector pGAprEHS of Example 1 was transferred into the FZB42 strain by the chemically competent transformation method to obtain the intermediate engineering bacteria FZB42 / AHS; Next, the nprE gene site-directed mutagenesis vector pUNprEK of Example 2 was transformed into the intermediate engineering strain FZB42 / AHS to construct the engineered strain FZB42 / ANHSK expressing Harpin protein; finally, the vector pBR1-Cre capable of expressing the recombinase protein Cre It was transferred into the engineered strain FZB42 / ANHSK, and the antibiotic marker gene was cut out, and the target engineering strain was successfully constructed, the Bac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a recombinant vector pGAprEHS for expressing Harpin protein and engineering bacteria thereof. An encoding gene of the Harpin protein is cloned into an expression vector so as to establish a bacillus subtilis recombinant vector pGAprEHS for expressing the Harpin protein; the bacillus subtilis recombinant vector pGAprEHS is then recombined into an alkaline proteolytic enzyme aprE gene locus on a bacillus subtilis chromosome to obtain intermediate engineering bacteria; an nprE gene locus mutation vector pUNprEK is then converted into the intermediate engineering bacteria so as to knock another intermediate proteolytic enzyme nprE gene out and establish bacillus subtilis gene engineering bacteria FZB42/ANHSK which is deficient of two proteolytic enzymes and used for expressing the Harpin protein; and finally, an antibiotic screening mark is removed from the engineering bacteria by means of a Cre/lox recombinant enzyme system to obtain the engineering bacteria which are safer and more friendly to environment, people and livestock.

Description

technical field The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant vector pGAprEHS expressing Harpin protein and engineering bacteria thereof. Background technique Harpin protein is a protein encoded by some (or some) genes in the hrp gene cluster (hypersensitive reaction and pathogenicity gene cluster) in plant pathogenic bacteria. It is a non-specific elicitor and can induce plant disease resistance in non-host plants , can also initiate a variety of signal transduction pathways in plants, such as inducing plant production systems to acquire disease resistance (systemic acquired resistance, SAR) through the salicylic acid (salicylic acid, SA) signaling pathway, and promoting plant growth and Stress resistance, insect resistance is induced through jasmonic acid (jasmonic acid, JA) regulation signal pathway. In 1992, Dr. Zhongmin Wei of Cornell University in the United States first discovered that the hrpN gene p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/75C12N1/21A01N63/00A01P21/00A01P3/00A01P1/00A01P7/04C12R1/125
Inventor 高学文乔俊卿伍辉军沈波
Owner 无锡亚克生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap