Coding region of rice blast resistant gene Pi 25 and application thereof

A technology for a rice blast resistance gene and coding region, which is applied to the field of isolation, cloning and application of the coding region of the rice blast resistance gene Pi25, can solve problems such as unproven problems, and achieve the effects of improving the efficiency of variety selection and shortening the breeding time.

Active Publication Date: 2010-09-08
CHINA NAT RICE RES INST
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Pib gene is one of the members of the small family. It originated from indica rice in Southeast Asia and is widely used in Japan. It is highly resistant to most of the races in Japan. However, it has not been proved that it is a broad-spectrum rice blast resistance gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coding region of rice blast resistant gene Pi 25 and application thereof
  • Coding region of rice blast resistant gene Pi 25 and application thereof
  • Coding region of rice blast resistant gene Pi 25 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Genetic Analysis and Preliminary Mapping of Rice Blast Resistance Gene Pi25

[0034] First, in order to discover and identify new blast resistance genes, the indica rice resistant variety Gumei 2 was crossed with the indica susceptible variety Zhong 156, and a recombinant inbred line consisting of 304 individual plants was constructed by single-seed transmission method , using this recombinant inbred line population to conduct an in-depth study on the rice blast resistance inheritance of Gumei 2, and identified and mapped Pi24, Pi25, Pi26 and Pib gm Four blast resistance major genes and more than ten QTLs. Pi25 is a gene for both seedling blast and panicle blast resistance, located on chromosome 6 of rice. (Such as figure 1 shown)

Embodiment 2

[0035] Example 2: Fine Mapping of New Rice Blast Resistance Gene Pi25

[0036] The invention utilizes map-position cloning and bioinformatics methods to clone the coding region of the resistance gene Pi25. In order to fine-tune the main effect gene, a new recombinant inbred line (containing 1384 strain) for fine mapping of Pi25, and determined that Pi25 was located between the markers RG456 and A7. Using bioinformatics methods, it was found that there were 8 overlapping bacterial artificial chromosome (BAC) clones between RG456 and A7, with a total of 132 candidate genes, and one gene related to NB-ARC structural resistance was located on the BAC clone AP004325, so the The resistance-related gene located on AP004325 was identified as a candidate gene. ( figure 1 )

Embodiment 3

[0037] Example 3: Isolation and sequence analysis of the coding region of the rice blast resistance gene Pi25 candidate gene

[0038] In order to isolate the candidate gene of Pi25, using the reference sequence of Nipponbare, through PRIME3( http: / / frodo.wi.mit.edu / cgi-bin / primer3 / primer3www.cgi ) on-line primer design software to design candidate gene-specific primers, and isolate the candidate gene by PCR with high-fidelity Taq enzyme (Invitrogen); the PCR amplification product is connected to the pGEM-Teasy vector (Promega, CA: A1380) after purification, And transformed into Escherichia coli JM109 (Promega, CA: A1380) for preservation; the positive plasmid verified by enzyme digestion of the ligation product was sent to Invitrogen for sequencing. The sequence was predicted by the gene prediction software GENSCAN( http: / / genes.mit.edu / GENSCAN.html ) carried out gene prediction and annotation analysis on the target gene region, and preliminarily determined that Pi25 is a d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to isolation, cloning and application of a coding region of a rice blast resistant gene Pi 25, and discloses the nucleotide sequence of the rice blast resistant gene Pi 25, SEQ ID No.1, and the amino acid sequence of a coded protein thereof, SEQ ID No.2. The transfer of the Pi 25 gene coding region into an infected plant is beneficial to generating a new disease resistant plant, especially accumulating multiple disease resistant genes by a hybridization and transformation method without generating the problem of linkage drag in a genome accompanying in the traditional breeding technique; and the breeding time can be shortened, and the selective-breeding efficiency can be raised. The cloning of the disease resistant genes is the foundation to solve the obstacle existing in interspecific gene transfer in the traditional breeding. The invention also provides a primer pair for amplifying the rice blast resistant gene Pi25, SEQ ID No:3 and SEQ ID No:4, wherein the nucleotide sequence of the SEQ ID No:3 is GGGGTACCCCATCGGCAGTGTAGCGTTTTT, and the nucleotide sequence of the SEQ ID No:4 is GCTCTAGAGCGCAATCGTGGAACAGGAAT. The invention also provides a vector containing the coding region of the rice blast resistant gene Pi25.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the isolation, cloning and application of a rice blast resistance gene Pi25 coding region. Background technique [0002] Rice is an important food crop in my country, responsible for the rations of more than 95% of the country's population. However, during the planting process of rice, it is often harmed by diseases, resulting in severe yield reduction. Rice blast is an important disease of rice caused by the Ascomycete Magaporthe oryzea, which has been found in 85 countries. According to statistics, during 1975-1990, the grain loss caused by blast fungus accounted for 11-30% of the global total output, about 15.7 billion tons. During the 22 years from 1980 to 2002, rice blast occurred on an average of 2.8 million mu in Sichuan Province of my country, with an average annual loss of 60 million kilograms of rice. In 2005, the area of ​​rice blast in Heilongjiang Prov...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/11C12N15/63
Inventor吴建利陈洁庄杰云施勇烽
OwnerCHINA NAT RICE RES INST