Unlock instant, AI-driven research and patent intelligence for your innovation.

Immunomodifier for reducing blood total cholesterol and administration method thereof

A technology of total cholesterol and cholesterol, applied in the direction of drug combination, metabolic diseases, bacterial antigen components, etc., can solve the problem that there is no specific difference between immune pathways and immune strategies

Inactive Publication Date: 2010-11-03
CHINA PHARM UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These two methods are widely used in the prevention of autoimmune diseases, but there is no specific difference between the two in terms of immune pathways and immune strategies, mainly related to specific diseases and antigens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunomodifier for reducing blood total cholesterol and administration method thereof
  • Immunomodifier for reducing blood total cholesterol and administration method thereof
  • Immunomodifier for reducing blood total cholesterol and administration method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Cloning of HSP65 gene

[0043] Genomic DNA was extracted from commercially available BCG (refer to the "Refined Molecular Biology Experiment Guide" for specific steps), and the full gene sequence of HSP65 in BCG was found by National Center for Biotechnology Information (NCBI). Under the premise of not changing the amino acid sequence of HSP65, codons favored by Escherichia coli were selected, and two primers P1 and P2 were designed with the help of computer software.

[0044] The nucleotide sequences of the two primers are as follows:

[0045] P1: 5'TTCG CCATGG CCAAHACA ATTGCGTACG 3’

[0046] P2: 5'TTCCG AAGCTT AGAAATCCATGCCACCCATG 3'

[0047] An NcoI restriction site was introduced into the upstream primer P1, and a HindIII restriction site was introduced into the downstream primer P2.

[0048] The PCR reaction system is: 100 pmol P1, 100 pmol P2, 2 μg BCG genomic DNA, 2 μl dNTP (10 mM), 5 μl 10×Pfu buffer and 5 units of Pfu DNA polymerase, the to...

Embodiment 2

[0050] Example 2: Expression of HSP65 in Escherichia coli

[0051] Pick a single colony from the pET-28a-HSP65 plate and inoculate it into 5ml of LB medium containing 50 μg / ml kanamycin, cultivate overnight at 37°C with constant temperature shaking, and transfer to fresh corn steep liquor liquid medium (50 μg / ml kanamycin), after culturing at 37°C for 4 hours, α-lactose with a final concentration of 5mmol / L was added to induce recombinant E. coli to express protein HSP65. After 6 hours of induction, the engineered bacteria recovered the thalline through centrifugation, suspended the thalline in the thalline lysate (pH8.0, 10mmol / L Tris-HCl buffer solution, 0.02% lysozyme), freeze-thawed once, added DNase I to The DNA was digested until the solution was no longer viscous, the supernatant was recovered by centrifugation, the ammonium sulfate was fractionated and precipitated, and 35-40% of the precipitate was redissolved in the ion exchange buffer (10mmol / L Tris-HCl, pH8.0), an...

Embodiment 4

[0052] Embodiment 4: Pharmacodynamic study of HSP65 recombinant protein

[0053] Twenty-four 6-week-old male C57BL / 6 mice were randomly divided into 3 groups, 8 mice in each group, which were PBS blank group, OVA (ovalbumin) nasal mucosa immunization group and HSP65 nasal mucosa immunization group. Animals were fed with high-fat and high-cholesterol feed (10% lard, 2% cholesterol and 0.5% bile salt were added to common mouse feed). Immunization started after 20 days, once a day for 10 consecutive days. The HSP65 recombinant protein was dissolved in sterilized PBS, quantified by the Coomassie Brilliant Blue Kit, configured to 1 μg / μl, and instilled from the nasal cavity, 20 μl per mouse, containing 20 μg protein. The change of serum cholesterol after immunization was detected. Blood was collected from the retro-orbital venous plexus 14 days after the 10th immunization, about 0.2ml per mouse, centrifuged at 4000 rpm for 10 minutes, and the serum was collected. The total chole...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides novel application of bacillus tuberculosis typus bovinus heat shock protein 65 in prevention and treatment of atherosclerosis, an administration method and an administration dosage for achieving the application. The bacillus tuberculosis typus bovinus heat shock protein 65 of the invention is obtained by means of gene engineering and biological engineering. The bacillus tuberculosis typus bovinus heat shock protein 65 has the pharmacological properties of reducing blood total cholesterol and increasing reverse cholesterol transport related gene expression.

Description

technical field [0001] This application relates to the field of cardiovascular diseases. Specifically, the present invention relates to the application of heat shock protein 65 of Mycobacterium bovis tuberculosis and the protein composition containing whole Mycobacterium tuberculosis heat shock protein 65 in treating and / or preventing atherosclerosis. Background technique [0002] Atherosclerosis (AS) is one of the common cardiovascular diseases and one of the diseases with the highest mortality rate in modern times. The accumulation of a large amount of lipids on the arterial wall is the main symptom of atherosclerosis. It is also a chronic inflammatory process. Innate and adaptive immune responses not only participate in the formation of atherosclerotic plaques, but also erode the arterial wall, reducing the Arterial elasticity, which affects blood flow. Atherosclerotic plaques often narrow the arterial lumen, further inducing thromboembolism, causing ischemia, and somet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/04A61P3/06A61P37/02
Inventor 刘景晶张宇胡向兵张会勇鲁勇曹荣月李泰明
Owner CHINA PHARM UNIV