The Cry8Na1 gene of bacillus thuringiensis, expression protein and application thereof
A Bacillus thuringiensis, gene expression technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of singleness and the increase of pest resistance, achieve wide application prospects and delay the effect of drug resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1, isolate Bacillus thuringiensis bacterial strain BTQ52-7
[0038] The applicant's laboratory staff obtained a strain of Bacillus thuringiensis isolated from the soil near Yuantongguan, Qianshan, Liaoning. The spores of Bacillus thuringiensis are the outer wall of the spore, the coat of the spore, the cortex, the inner wall of the spore, the plasma membrane and the inner wall of the spore. protoplast. The main component of the cortex is peptidoglycan, a polysaccharide teichoic acid that does not contain vegetative cells, and it maintains the dehydration state and heat resistance of the spores. On the other hand, during the formation of the spores, a large amount of DPA-Ca will be produced. thuringiensis spores will not die and dormant spores are treated at a sub-lethal temperature of 75°C for 15 minutes, and the activation effect is the best , not only promote its rapid germination, but also improve the survival rate of spores (Yu Ziniu 1990). According to...
Embodiment 2
[0054] Example 2. Obtaining new genes
[0055] 2.1 Detection of strain BTQ52-7 by using cry8 gene universal primers, the primers are as follows
[0056]
[0057] Amplification cycle: denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, extension at 72°C for 4 minutes, 25 cycles, and finally extension at 72°C for 10 minutes.
[0058] The result is as image 3 As shown, after sequencing, nucleic acid and amino acid comparisons found that it was a new gene.
[0059] 2. Cloning of cry8 gene in 1BTQ52-7 strain
[0060] The new cry gene in the strain was isolated and cloned by rapid cloning method.
[0061] A pair of primers for amplifying the full-length cry8 gene were designed with reference to the 5' and 3' sequences of the cry8 gene coding region published in GenBank. The primer sequences are as follows:
[0062] cry8N5: 5′-3′: TTACTCTTTCTTCTAACACGAGTTTCTACAC
[0063] cry8N3: 5′-3′: ATGAGTCCGAATAATCAAAACGAAT
Embodiment 3
[0125] 3.1 Plasmid DNA was extracted from the above clone, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.
[0126] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.
[0127] The process of inducing expression is as follows:
[0128] 1) Activated strains (37°C, 12hr);
[0129] 2) 10% inoculated in LB medium (37°C, 2hr);
[0130] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;
[0131] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;
[0132] 5) Broken bacteria (ultrasonic crushing is complete);
[0133] Centrifuge at 12,000rpm for 10min at 4°C;
[0134] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.
[0135] The polyacrylamide gel configuration is as follows.
[0136] Separating gel 8% (ml) Stacking gel 5% (ml)
[0137] Distilled water 4....
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 