Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

The Cry8Na1 gene of bacillus thuringiensis, expression protein and application thereof

A Bacillus thuringiensis, gene expression technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of singleness and the increase of pest resistance, achieve wide application prospects and delay the effect of drug resistance

Active Publication Date: 2011-03-09
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Since the current commercialized transgenic insect-resistant crops have a single type of insect-resistant gene, such a large-scale promotion of planting has the risk of reducing pest refuges and increasing pest resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The Cry8Na1 gene of bacillus thuringiensis, expression protein and application thereof
  • The Cry8Na1 gene of bacillus thuringiensis, expression protein and application thereof
  • The Cry8Na1 gene of bacillus thuringiensis, expression protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1, isolate Bacillus thuringiensis bacterial strain BTQ52-7

[0038] The applicant's laboratory staff obtained a strain of Bacillus thuringiensis isolated from the soil near Yuantongguan, Qianshan, Liaoning. The spores of Bacillus thuringiensis are the outer wall of the spore, the coat of the spore, the cortex, the inner wall of the spore, the plasma membrane and the inner wall of the spore. protoplast. The main component of the cortex is peptidoglycan, a polysaccharide teichoic acid that does not contain vegetative cells, and it maintains the dehydration state and heat resistance of the spores. On the other hand, during the formation of the spores, a large amount of DPA-Ca will be produced. thuringiensis spores will not die and dormant spores are treated at a sub-lethal temperature of 75°C for 15 minutes, and the activation effect is the best , not only promote its rapid germination, but also improve the survival rate of spores (Yu Ziniu 1990). According to...

Embodiment 2

[0054] Example 2. Obtaining new genes

[0055] 2.1 Detection of strain BTQ52-7 by using cry8 gene universal primers, the primers are as follows

[0056]

[0057] Amplification cycle: denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, extension at 72°C for 4 minutes, 25 cycles, and finally extension at 72°C for 10 minutes.

[0058] The result is as image 3 As shown, after sequencing, nucleic acid and amino acid comparisons found that it was a new gene.

[0059] 2. Cloning of cry8 gene in 1BTQ52-7 strain

[0060] The new cry gene in the strain was isolated and cloned by rapid cloning method.

[0061] A pair of primers for amplifying the full-length cry8 gene were designed with reference to the 5' and 3' sequences of the cry8 gene coding region published in GenBank. The primer sequences are as follows:

[0062] cry8N5: 5′-3′: TTACTCTTTCTTCTAACACGAGTTTCTACAC

[0063] cry8N3: 5′-3′: ATGAGTCCGAATAATCAAAACGAAT

[0064] Using the plasmid DNA of bacterial stra...

Embodiment 3

[0125] 3.1 Plasmid DNA was extracted from the above clone, and transformed into the recipient strain Rosetta (DE3) to obtain an expression strain.

[0126] After IPTG induced expression, SDS-PAGE protein electrophoresis was performed.

[0127] The process of inducing expression is as follows:

[0128] 1) Activated strains (37°C, 12hr);

[0129] 2) 10% inoculated in LB medium (37°C, 2hr);

[0130] 3) Add the inducer IPTG, 150rpm, and induce at 18-22°C for 4-20h at low temperature;

[0131] 4) The cells were collected by centrifugation, and 10 mM Tris Cl (pH 8.0) was added to suspend;

[0132] 5) Broken bacteria (ultrasonic crushing is complete);

[0133] Centrifuge at 12,000rpm for 10min at 4°C;

[0134] Collect 10-15 μL each of the supernatant and the precipitate, and detect them by electrophoresis.

[0135] The polyacrylamide gel configuration is as follows.

[0136] Separating gel 8% (ml) Stacking gel 5% (ml)

[0137] Distilled water 4....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the Cry8Na1 gene of Bacillus thuringiensis (Bt), expression protein and application thereof, which belongs to the field of biological control. The preservation number of Bt strains BTQ52-7 is CGMCC No.4188. The amino acid sequence of the insecticidal protein is shown in SEQ ID No.2. Preferred nucleotide sequences of genes encoding the above insecticidal protein is shown in SEQ ID No.1. The above genes with high virulence to coleoptera insects are applicable for transforming micro-organisms and plants. Thus the transformed micro-organisms and plants are resistant to relevant insects. The development of drug resistance of insects to engineering bacteria and transgenic plants can also be overcome or delayed.

Description

technical field [0001] The invention relates to the technical field of biological control, in particular to the Bt cry8Nal gene with high toxicity to coleopteran pests and the protein encoded by the gene. Background technique [0002] Bacillus thuringiensis (Bt) is a widely distributed Gram-positive bacterium, an entomopathogenic microorganism with strong toxicity to pests and no toxicity to natural enemies, and no toxicity to higher animals and humans. It is currently the most in-depth study and the most widely used microbial insecticide, and it is active against more than 3000 kinds of pests in 16 orders. Bt can form insecticidal crystal proteins (Insecticidal Crystal Proteins, ICPs), also known as delta-endotoxin (delta-endotoxin) in the sporulation stage, its shape, structure and size are closely related to its virulence [Schnepf.E, Crickmore .N, Van Rie.J., Lereclus.D, Baum.J, Feitelson.J, Zeigler.D.R., Dean.D.H.Bacillus thuringiensis and its pesticidal crystalproteins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N15/32C12N15/63C12N1/15C12N1/19C12N1/21C07K14/325A01N63/02A01P7/04C12R1/07
Inventor 高继国李海涛刘荣梅赫福霞张杰宋福平
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products