Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting swine fever viruses

A swine fever virus and kit technology, which is applied in the field of swine fever virus detection kits, can solve the problem that the detection method cannot adapt to the needs of rapid, sensitive and accurate detection, and avoid large-scale infection and high sensitivity. Effect

Active Publication Date: 2013-04-24
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is to overcome the inability of existing detection methods to meet the fast, sensitive and accurate detection requirements, thereby providing a kind of test kit for detecting swine fever virus that can detect viruses quickly, sensitively and accurately, The invention also provides the detection method of the kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting swine fever viruses
  • Kit for detecting swine fever viruses
  • Kit for detecting swine fever viruses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] 1. Design and preparation of primers

[0041] Refer to GenBank (gene bank) to search for multiple strains, search for regions that are conserved on multiple sequences for sequence comparison, and design three pairs of relatively conservative specific primers according to the comparison results. The primer sequences are as follows:

[0042] The primer sequence of the 619bp band is:

[0043] Upstream primer TCAGGGGGATGTGCAGAGATGTGT (SEQ ID NO: 1)

[0044] Downstream primer GCTTTTTCCGCGCCTGATTGATA (SEQ ID NO: 2)

[0045] The primer sequence of the 395bp band is:

[0046] The upstream primer is CCGCCGGTGATTTCGTG (SEQ ID NO: 3)

[0047] The downstream primer is ACTGCCTCTTTGCCCTTTTCCTTAT (SEQ ID NO: 4)

[0048] The primer sequence of the 274bp band is:

[0049] The upstream primer is CTGGCCAAGAGGGGTGAGC (SEQ ID NO: 5)

[0050] The downstream primer is ACAGGCCGTCTTGGGTATTC (SEQ ID NO: 6)

[0051] The above primers were synthesized by Dalian Bao Biological Engineering Co...

Embodiment 2

[0076] 1. Design and preparation of primers: same as Example 1

[0077] 2. Sample preparation

[0078] (1) Take 400 μl of pig whole blood to be tested, put it into a 1.5mL eppendorf tube, add 1000 μl Trizol (nucleic acid extraction reagent), mix well, and place at 4°C for 5 minutes.

[0079] Step (2)-step (8) is the same as 2 in embodiment 1

[0080] 3, the preparation kit is the same as in Example 1 3

[0081] 4, detect swine fever virus with kit of the present invention

[0082] (1) The total PCR system is 25 μl. In the kit of the present invention, a. One Step RNA PCR mixture 10 μl; b. RNase inhibitor 0.5 μl; c. AMV reverse transcriptase 0.5 μl; d. Taq enzyme 0.5 μl; e. three pairs of primers 1.5 μl; f . Add 7 μl of RNase-free water into the 0.2ml amplification tube;

[0083] (2) Add 5 μl of RNA template extracted from pig whole blood to the above-mentioned amplification tube, centrifuge at 12,000 rpm for 5-30 seconds, put the amplification tube into the amplification ...

Embodiment 3

[0085] 1. Design and preparation of primers: same as Example 1

[0086] 2. Sample preparation

[0087] (1) Take 400 μl of porcine serum to be tested, put it in a 1.5mL eppendorf tube, add 1000 μl Trizol (nucleic acid extraction reagent), mix well, and place at 4°C for 5 minutes.

[0088] Step (2)-step (8) is the same as 2 in embodiment 1

[0089] 3, the preparation kit is the same as in Example 1 3

[0090] 4, detect swine fever virus with kit of the present invention

[0091] (1) The total PCR system is 25 μl. In the kit of the present invention, a. One StepRNA PCR mixed solution 10 μl; b. RNase inhibitor 0.5 μl; c. AMV reverse transcriptase 0.5 μl; d. Taq enzyme 0.5 μl; e. three pairs of primers 1.5 μl; . Add 7 μl of RNase-free water into the 0.2ml amplification tube;

[0092] (2) Add 5 μl of RNA template extracted from pig whole blood to the above-mentioned amplification tube, centrifuge at 12,000 rpm for 5-30 seconds, put the amplification tube into the amplification ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention relates to a kit for detecting swine fever viruses, which contains RNA (Ribonucleic Acid) enzyme inhibitor, an AMV (Avian Myeloblastosis Virus) reverse transcriptase, Taq enzyme (Thermal-resistant desoxyribonucleic acid polymerase), RNA-free enzyme water, One Step RNA PCR (one-step RNA Polymerase Chain Reaction) mixed solution, a positive and negative reference substance, and mixtures of primers with the sequences shown as SEQ ID NO.1 to SEQ ID NO.6. In the detection process, the reverse transcription process and the PCR amplification process are accomplished in one-step reaction, so that the detection time is shorten to 2-3 hours from the original time of 4-5 hours, thereby benefiting rapid detection. Simultaneously, as the kit uses three pairs of primers, compared with thecommon PCR method, the method has higher sensitivity, thereby contributing to prevention and control of CSFV (Classical Swine Fever Virus) and rejection of recessive poisonous animals, and avoiding resulting in large-range infection. The method is suitable for any laboratories, each-level prevention and control units in the basic government organization, veterinary stations, large, medium and small-size livestock farms and the like.

Description

technical field [0001] The present invention relates to a detection method of classical swine fever virus, in particular to a test kit for detection of classical swine fever virus, and the present invention also includes the detection method of the test kit. Background technique [0002] Classical swine fever (CSF), referred to as classical swine fever, is an acute, severe, and contagious infectious disease of pigs caused by classical swine fever virus (CSFV). my country is one of the most endemic countries for severe swine fever Every year, the direct economic loss caused by swine fever has billions of yuan, which seriously threatens the development of my country's pig industry and its international trade. my country is the country with the largest number of pigs in the world, and the pig industry has become a major pillar industry of my country's animal husbandry industry. However, the number of pigs that die each year due to swine fever infection accounts for 2% to 5% of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 刘湘涛吴锦艳田宏陈妍尚佑军尹双辉王光祥靳野张克山杨顺利
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI