Kit for detecting swine fever viruses
A swine fever virus and kit technology, which is applied in the field of swine fever virus detection kits, can solve the problem that the detection method cannot adapt to the needs of rapid, sensitive and accurate detection, and avoid large-scale infection and high sensitivity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] 1. Design and preparation of primers
[0041] Refer to GenBank (gene bank) to search for multiple strains, search for regions that are conserved on multiple sequences for sequence comparison, and design three pairs of relatively conservative specific primers according to the comparison results. The primer sequences are as follows:
[0042] The primer sequence of the 619bp band is:
[0043] Upstream primer TCAGGGGGATGTGCAGAGATGTGT (SEQ ID NO: 1)
[0044] Downstream primer GCTTTTTCCGCGCCTGATTGATA (SEQ ID NO: 2)
[0045] The primer sequence of the 395bp band is:
[0046] The upstream primer is CCGCCGGTGATTTCGTG (SEQ ID NO: 3)
[0047] The downstream primer is ACTGCCTCTTTGCCCTTTTCCTTAT (SEQ ID NO: 4)
[0048] The primer sequence of the 274bp band is:
[0049] The upstream primer is CTGGCCAAGAGGGGTGAGC (SEQ ID NO: 5)
[0050] The downstream primer is ACAGGCCGTCTTGGGTATTC (SEQ ID NO: 6)
[0051] The above primers were synthesized by Dalian Bao Biological Engineering Co...
Embodiment 2
[0076] 1. Design and preparation of primers: same as Example 1
[0077] 2. Sample preparation
[0078] (1) Take 400 μl of pig whole blood to be tested, put it into a 1.5mL eppendorf tube, add 1000 μl Trizol (nucleic acid extraction reagent), mix well, and place at 4°C for 5 minutes.
[0079] Step (2)-step (8) is the same as 2 in embodiment 1
[0080] 3, the preparation kit is the same as in Example 1 3
[0081] 4, detect swine fever virus with kit of the present invention
[0082] (1) The total PCR system is 25 μl. In the kit of the present invention, a. One Step RNA PCR mixture 10 μl; b. RNase inhibitor 0.5 μl; c. AMV reverse transcriptase 0.5 μl; d. Taq enzyme 0.5 μl; e. three pairs of primers 1.5 μl; f . Add 7 μl of RNase-free water into the 0.2ml amplification tube;
[0083] (2) Add 5 μl of RNA template extracted from pig whole blood to the above-mentioned amplification tube, centrifuge at 12,000 rpm for 5-30 seconds, put the amplification tube into the amplification ...
Embodiment 3
[0085] 1. Design and preparation of primers: same as Example 1
[0086] 2. Sample preparation
[0087] (1) Take 400 μl of porcine serum to be tested, put it in a 1.5mL eppendorf tube, add 1000 μl Trizol (nucleic acid extraction reagent), mix well, and place at 4°C for 5 minutes.
[0088] Step (2)-step (8) is the same as 2 in embodiment 1
[0089] 3, the preparation kit is the same as in Example 1 3
[0090] 4, detect swine fever virus with kit of the present invention
[0091] (1) The total PCR system is 25 μl. In the kit of the present invention, a. One StepRNA PCR mixed solution 10 μl; b. RNase inhibitor 0.5 μl; c. AMV reverse transcriptase 0.5 μl; d. Taq enzyme 0.5 μl; e. three pairs of primers 1.5 μl; . Add 7 μl of RNase-free water into the 0.2ml amplification tube;
[0092] (2) Add 5 μl of RNA template extracted from pig whole blood to the above-mentioned amplification tube, centrifuge at 12,000 rpm for 5-30 seconds, put the amplification tube into the amplification ...
PUM
Property | Measurement | Unit |
---|---|---|
thickness | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap