Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same

An alcohol dehydrogenase and surface display technology, which is applied in the field of recombinant fusion proteins to achieve the effects of stable biological activity, simple and rapid preparation method and separation process, and large expression amount

Inactive Publication Date: 2011-09-07
JIANGSU UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the basis of maintaining the physiological characteristics of Bacillus subtilis spores, the product of the present invention has significantly improved catalytic stability to ethanol compared with the original silkworm alcohol dehydrogenase protein, and no similar reports and invention patents have been seen so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same
  • Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same
  • Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1: Bombyx mori alcohol dehydrogenase Bmadh Cloning, sequencing and identification of genes

[0033] The silkworm species used in the present invention are provided by the School of Life Sciences, Jiangsu University. The midgut tissue of silkworm was taken, put into a mortar pre-cooled with liquid nitrogen, added liquid nitrogen for grinding, mRNA was isolated with RNA extraction kit, and the cDNA sequence of alcohol dehydrogenase gene of silkworm was obtained by reverse transcription PCR technology.

[0034] Bombyx mori alcohol dehydrogenase Bmadh The primers for PCR amplification of gene fragments are:

[0035] Bmadh -F: 5'- GGGGTACC ATGGCACCGGATTTCGTGAAGCGTT-3' (SEQ ID NO.1), the underline indicates the KpnI restriction site;

[0036] Bmadh -R: 5'- CGAGCTC CTATGTCTTGGAGAGTATTTGGA-3' (SEQ ID NO.2), the underline indicates the SacI restriction enzyme cutting site.

[0037] PCR reaction system according to TaKaRa LA Taq The instructions for use...

Embodiment 2

[0039] Example 2: Preparation of Bacillus subtilis recombinant spores displaying BmADH using CotC as a carrier

[0040] 1. Construction of recombinant integrated plasmid pJS700-BmADH

[0041] Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) was provided by Ningde, School of Environment, Jiangsu University Donated by Associate Professor Gang, the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE 5'-end and amyE 3'-end respectively represent the amylase gene amyE (GenBank accession number: NP_388186) The 5' and 3' ends of the coding sequence were integrated into Bacillus subtilis 168 ( trp - ) in the amylase gene of the chromosome.

[0042] amylase gene amyE The PCR amplification primers are:

[0043] amy E-F: ATTGCTCGGGCTGTATGACTGG (SEQ ID NO. 4)

[0044] amy E-R: GTTACACCATCACTGTTCGTTCCTT (S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

In the invention which belongs to the technical field of recombinant fusion proteins, silkworm alcohol dehydrogenases as exogenous proteins are displayed on surfaces of bacillus subtilis. Capsid protein genes cotC of spores of the bacillus subtilis, serving as molecular vectors, are recombined with silkworm alcohol dehydrogenase genes Bmadh to produce integrated recombinant plasmids which express the silkworm alcohol dehydrogenases BmADH in a fused manner so as to convert the bacillus subtilis; and exogenous genes are integrated in amylase genes amyE at special positions on a chromosome through homologous recombination, and the amylase genes are damaged, so that recombinant strains are free of the activities of the amylase genes; and therefore, recombinant bacillus subtilis strains containing fusion expressions CotC-BmaDH are successfully screened. Spores with fused proteins of silkworm alcohol dehydrogenases displayed on the surfaces are obtained through the inducible expression of the recombinant strains. In the invention, original alcohol dehydrogenases with instable temperature and pH become the fused proteins of the alcohol dehydrogenases with relatively stable activities under different environmental environments, and produced recombinant spores can be used for the direct oral administration of animals.

Description

technical field [0001] The invention belongs to the technical field of recombinant fusion protein. Specifically, it relates to a method for displaying alcohol dehydrogenase as an exogenous active protein on the surface of Bacillus subtilis and recombinant spores. Specifically, it refers to: using the property of Bacillus subtilis that can survive for a long time under adverse conditions such as extreme temperature, dryness, and exposure to organic solvents and other toxic chemicals, the active alcohol dehydrogenase gene and The spore capsid protein gene is recombined and expressed, so that the alcohol dehydrogenase that is unstable to temperature and pH becomes an alcohol dehydrogenase fusion protein that has relatively stable activity under different environmental conditions. Background technique [0002] Alcohol dehydrogenase (ADH) belongs to the oxidoreductase family, which can use nicotinamide adenine dinucleotide (NAD) as a coenzyme to catalyze the reversible reaction ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/75C12N1/21C12R1/125
CPCC07K14/32C12N9/0006C12N15/75
Inventor 陈克平王楠宁德刚李国辉姚勤
Owner JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com