Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same
An alcohol dehydrogenase and surface display technology, which is applied in the field of recombinant fusion proteins to achieve the effects of stable biological activity, simple and rapid preparation method and separation process, and large expression amount
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1: Bombyx mori alcohol dehydrogenase Bmadh Cloning, sequencing and identification of genes
[0033] The silkworm species used in the present invention are provided by the School of Life Sciences, Jiangsu University. The midgut tissue of silkworm was taken, put into a mortar pre-cooled with liquid nitrogen, added liquid nitrogen for grinding, mRNA was isolated with RNA extraction kit, and the cDNA sequence of alcohol dehydrogenase gene of silkworm was obtained by reverse transcription PCR technology.
[0034] Bombyx mori alcohol dehydrogenase Bmadh The primers for PCR amplification of gene fragments are:
[0035] Bmadh -F: 5'- GGGGTACC ATGGCACCGGATTTCGTGAAGCGTT-3' (SEQ ID NO.1), the underline indicates the KpnI restriction site;
[0036] Bmadh -R: 5'- CGAGCTC CTATGTCTTGGAGAGTATTTGGA-3' (SEQ ID NO.2), the underline indicates the SacI restriction enzyme cutting site.
[0037] PCR reaction system according to TaKaRa LA Taq The instructions for use...
Embodiment 2
[0039] Example 2: Preparation of Bacillus subtilis recombinant spores displaying BmADH using CotC as a carrier
[0040] 1. Construction of recombinant integrated plasmid pJS700-BmADH
[0041] Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis displaying WSSV envelope proteins Vp19 and Vp28 on the surface of CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) was provided by Ningde, School of Environment, Jiangsu University Donated by Associate Professor Gang, the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE 5'-end and amyE 3'-end respectively represent the amylase gene amyE (GenBank accession number: NP_388186) The 5' and 3' ends of the coding sequence were integrated into Bacillus subtilis 168 ( trp - ) in the amylase gene of the chromosome.
[0042] amylase gene amyE The PCR amplification primers are:
[0043] amy E-F: ATTGCTCGGGCTGTATGACTGG (SEQ ID NO. 4)
[0044] amy E-R: GTTACACCATCACTGTTCGTTCCTT (S...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 