cDNA of glutathione-s-transferase (GST) gene in ostrinia furnacalis and method for constructing RNAi interference engineering bacteria of GST gene in ostrinia furnacalis
A technology of glutathione and transferase, which is applied in DNA/RNA fragment, genetic engineering, transferase and other directions, can solve the problem that there is no report on the glutathione-S-transferase gene of corn borer, and achieves low cost, The effect of inhibiting growth and development and reducing tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0015] Specific embodiment 1: In this embodiment, the cDNA of the corn borer glutathione-S-transferase gene has a full length of 886 bp, and the nucleotide sequence is:
[0016] TCGCGGATCCACAGCCTACTGATGATCAGTCGATGGAAAAGTCTTACTGTGGAGTTCTGAAGCGGTGCACGCGAGTTTCAAAGCTACA TCGATCGACCTTTACTACACGGCCGGGTCAGCGCCCTGTCGCCTGGTGTTACTGGTGGCTGCCGCTCTGAACCTCGAACTCAACCTTAAGCCTCTAGACTTAAGGGCTGGAGAACAGCTCACACCAGAATTTTTACAGCTGAACCCACAACACACAGTTCCCACGATCATAGACGACGGCTTTTCGCTAAATCCTCCACACACAGTTCCCACGATCGTAGACGACGGCTTTTCGCTATGGGAATCGCGCGCCATCAGCCGATACCTGGTCAACAAGTACGGAGGGGCAGCCCTGTACCCTGAGGACCCGAAGGCGAGGGCTTTGGTGGACCAGAGACTGGACTTCGACTTGGGTACACTGTACCCCAGATTTGCGACGTACTTTTATCCCCAAGTCCTCGCTGGTGCTCCTGCTGACGAAGCCTTGTTGAAGATGCTGGAAGAGGCTCTCAAGTTCCTGGACACCTTCCTCGAAGGTCAGAAGTATGCTGCGGGCTCAGAACTGACCTTGGCTGACCTGTCGCTCGTGGCTACTGTGTCTACTATTGACGCTGCTGGCATATCCATCGAATCCTACCAGAGTGTCAACAAGTGGTTCACGCTGGTCAAATCTACCGCCCCCAAATACGACGAAGCGAACGGCCAAGGCGTAGAAATGTTTAGAGCCTTCGTGGCACAGCTCAAAGCCAAGACGGAGCTG TCGTGAGACTGGTATAGTGCATAGTTTT...
specific Embodiment approach 2
[0021] Specific implementation manner 2: In this embodiment, the construction of the corn borer glutathione-S-transferase gene RNAi interference engineering bacteria is carried out according to the following steps: 1. Use the Trizol method to extract the total RNA of the midgut of the third instar larvae of the corn borer, and use the cDNA reverse The transcription kit synthesizes the first strand of cDNA, and design the specific upstream primer Of-GST-RNAi320-P1 and downstream primer Of-GST-RNAi320-P2 according to the specific functional dsRNA fragment, and then use the cDNA first strand obtained above as The template was amplified by PCR to obtain the target fragment Of-GST-RNAi320; 2. The target fragment Of-GST-RNAi320 and the expression vector L4440 were double-enzyme digested with Pst I and HindIII respectively, and the required target fragments were recovered, connected and constructed a recombinant plasmid L4440-Of-GST; 3. Transform the constructed recombinant plasmid L44...
specific Embodiment approach 3
[0027] Specific embodiment three: This embodiment is different from the specific embodiment two in that the Of-GST-RNAi320 double digestion system in step two is as follows:
[0028] Ingredients Dosage
[0029] Of-GST-RNAi320 10μL
[0030] Pst I 1μL
[0031] HindIII 1μL
[0032] 10×M Buffer 2μL
[0033] ddH 2 O 20μL.
[0034] Other steps and parameters are the same as in the second embodiment.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap