Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system

A technology of resveratrol and stilbene synthase, applied in the field of bioengineering, can solve problems such as high technical requirements, bacterial infection, and high inoculation work intensity, and achieve low transfection efficiency, simple operation process, and broad market prospects

Inactive Publication Date: 2012-09-19
SHANGHAI KEAI BIOLOGICAL TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Silkworm subcutaneous injection vaccination not only requires high technical requirements, but also needs to prevent bacterial infection, and the vaccination work is intensive and inefficient. Even skilled personnel are difficult to complete large-scale vaccination in a short period of time, and often miss the best time for virus vaccination.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system
  • Method for expressing resveratrol stilbene synthase and preparing resveratrol by utilizing insect system

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0037] Experimental Example 1: Acquisition of resveratrol stilbene synthase gene.

[0038] Grape buds were used as materials, total RNA was extracted by Trizol method, cDNA was obtained by reverse transcription with Oligo (dT18) primer, and RT-PCR was performed to amplify the resveratrol stilbene synthase gene. The primers were as follows:

[0039] Upstream primer: 5′-GGAAGGATCCATGCCGAATTATTCATACACCCCCCACCATCCAACGTGCCAAGGGTCC GGC;

[0040] Downstream primer: 5'-GGGCGTCGACTTAATTTGTAACCATAGC.

[0041] The PCR reaction system is:

[0042] wxya 2 O 20 μL

[0043] 10×PCR buffer

[0044] 2.5μL

[0045] (25mmol / L MgCl 2 )

[0046] 2.5mmol / L dNTP 0.5μL

[0047] Primer 1 0.5 μL

[0048] Primer 2 0.5 μL

[0049] Taq polymerase 0.5 μL

[0050] cDNA template 0.5 μL

[0051] Total 25μL

[0052] The reaction procedure of PCR is:

[0053] Pre-denaturation at 94°C for 5 minutes

[0054]

[0055] 72°C 10min

[0056] Finally stored at 4°C.

[0057] Pur...

Embodiment 2

[0058] Example 2 Preparation of Recombinant Bombyx mori Baculovirus

[0059] 1. Double digestion of pFast HTA and purified PCR product

[0060] In a sterile Eppendorf tube, sequentially add:

[0061] 10× buffer 5 μL

[0062] pFastBac HTA 42.5 μL

[0063] BamH I 1.5 μL

[0064] Sal I 1 μL

[0065] Total 50μL

[0066] 10× buffer 5 μL

[0067] Purified PCR product 42.5 μL

[0068] BamH I 1.5 μL

[0069] Sal I 1 μL

[0070] Total 50μL

[0071] Incubate at 37°C for 4 hours before use.

[0072] 2. Enzyme digestion product treatment

[0073] For the reaction system after double enzyme digestion, inactivate the restriction endonuclease in a 70°C water bath for 10 minutes. 1% gel electrophoresis, and the small fragments after PCR digestion and the large fragments of the pFastBac HTA vector were recovered by slicing the gel respectively. Purify and recover separately using a gel recovery kit.

[0074] 3. Ligation reaction

[0075] The purified PCR product was ligated with...

experiment example 3

[0101] Experimental Example 3 Inoculation of recombinant virus and purification of recombinant enzyme

[0102] 1. Vaccination

[0103] Use 3-day-old pupae as the inoculation object, disinfect the silkworm pupae epidermis (70% alcohol, edible alcohol), and puncture inoculate with about 100 pfu of recombinant virus per head. Under clean conditions, store at 28°C for 5-7 days, harvest silkworm chrysalis and store them at -20°C for later use.

[0104] 2. Purification of Recombinase

[0105] 1) silkworm chrysalis homogenate

[0106] a) Thaw raw silkworm chrysalis at 4°C (about 30 minutes), mix them with 0.85% normal saline at a weight ratio of 1:1; homogenize for 9 minutes until the slurry is fine and uniform;

[0107] 2) Low-speed centrifugation (using R10A3 rotor), followed by:

[0108] b) Add the homogenate into a 500ml centrifuge tube, balance, put the R10A3 rotor into the centrifuge, centrifuge at 3000rpm for 30min, take the supernatant, and carefully discard the oil;

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to view more

Abstract

The invention relates to a method for obtaining resveratrol stilbene synthase in an insect expression system. The method comprises the following steps of: adopting the Bac-to-Bac rhabdovirus expression system as well as the mode of replacing thirty basic groups at the end of resveratrol stilbene synthase gene5'with thirty basic groups at the end of rhabdovirus polyhedrosis gene 5'of a silkworm soas to enhance the high expression of resveratrol stilbene synthase genes in the insect system. The expression products of the resveratrol stilbene synthase are applied to the biotransformation of theresveratrol after purification. The technical scheme of the invention not only overcomes the problems of the chemical synthesis technology as well as the problem of low activity of obtained products of a prokaryotic expression system, achieves simple operation process and thorough utilization of pericarp wastes, conforms to the low carbon economic concept, and realizes industrialized production to meet market demand, thus having broader market prospect.

Description

technical field [0001] The invention relates to the field of bioengineering, in particular to a method for preparing resveratrol from resveratrol stilbene synthase expressed in an insect expression system, that is, the key enzyme (stilbene synthase) synthesized by utilizing the resveratrol expressed in an insect system ), the method for synthesizing resveratrol in vitro with the extract of watermelon rind or cantaloupe rind or grape skin etc. as substrate. Background technique [0002] The research on the medicinal value of resveratrol is more and more favored by scholars at home and abroad. Jang et al. published a series of reports on the inhibitory effect of resveratrol in the initiation, promotion and development of cancer in the journal Science, thus This makes resveratrol a research hotspot in the field of cancer chemoprevention and chemotherapy. [0003] In vitro experiments confirmed that resveratrol can inhibit platelet function and expression of TF in endothelial c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/52C12N15/866C12N7/01C12N9/00C12P7/22
Inventor 吕正兵高然叶甫云
Owner SHANGHAI KEAI BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap