Test strip for rapidly detecting plasmodia based on colloidal gold immunochromatographic assay, as well as antibodies and cell lines thereof
A malaria parasite and antibody technology, applied in the field of biochemistry, can solve the problems of inability to differentially diagnose falciparum malaria and mixed infection, and achieve the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Preparation and identification of the monoclonal antibody of the present invention
[0025] This example describes the preparation of anti-Plasmodium antibody materials used in the Plasmodium falciparum and Plasmodium vivax immunochromatographic methods of the present invention.
[0026] 1. Preparation of Plasmodium recombinant antigen:
[0027] PCR amplification of Plasmodium falciparum LDH (PfLDH) and Plasmodium vivax LDH (PvLDH) genes
[0028] PCR amplification of PfLDH gene
[0029] Using the genomic DNA of Plasmodium falciparum Hainan strain as a template, the PfLDH gene fragment was amplified by PCR, and the primers were:
[0030] PfLDH-P1: 5'-CCTCGAATTCATGGCACCAAAAGCAAAAATCGT-3' (SEQ NO. 1)
[0031] PfLDH-P2: 5'- CCCTGTCGACTTAAGCTAATGC2CT TCAT TCTCT -3' (SEQ NO.2)
[0032] The reaction was carried out in a 50 ml system. The cycle parameters were denaturation at 93°C for 5 minutes, 50 seconds at 93°C, 45 seconds at 60 seconds at 93°C, 30 cycles ...
Embodiment 2
[0059] Example 2 Colloidal gold rapid immunochromatographic test paper for detection of Plasmodium in the present invention
[0060] 1. Purification and colloidal gold labeling of 1H12 monoclonal antibody
[0061] 1H12 monoclonal antibody ascitic fluid was purified with Protein G Sepharose 4 Fast Flow column (Amersham). The 20-30nm colloidal gold solution was prepared by trisodium citrate reduction method. Adjust the pH value of colloidal gold to 7.2 with 0.1M potassium carbonate, add an appropriate amount of monoclonal antibody 1H12, stir at room temperature for 30 minutes, then add BSA to a final concentration of 1%, and continue stirring at room temperature for 30 minutes; discard the supernatant after high-speed centrifugation, and use 20mmol for precipitation / L TBS (pH 8.2) dissolved and stored at 4°C for later use.
[0062] When making gold label pads, take 2ml of the colloidal gold-antibody conjugate stock solution and dilute to 14ml with diluent. Soak the polyester...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap