Check patentability & draft patents in minutes with Patsnap Eureka AI!

Test strip for rapidly detecting plasmodia based on colloidal gold immunochromatographic assay, as well as antibodies and cell lines thereof

A malaria parasite and antibody technology, applied in the field of biochemistry, can solve the problems of inability to differentially diagnose falciparum malaria and mixed infection, and achieve the effect of simple operation

Inactive Publication Date: 2011-11-02
SOUTHERN MEDICAL UNIVERSITY
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage of this method is that when both antibody bands react, the differential diagnosis between P. falciparum and mixed infection cannot be carried out.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test strip for rapidly detecting plasmodia based on colloidal gold immunochromatographic assay, as well as antibodies and cell lines thereof
  • Test strip for rapidly detecting plasmodia based on colloidal gold immunochromatographic assay, as well as antibodies and cell lines thereof
  • Test strip for rapidly detecting plasmodia based on colloidal gold immunochromatographic assay, as well as antibodies and cell lines thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Preparation and identification of the monoclonal antibody of the present invention

[0025] This example describes the preparation of anti-Plasmodium antibody materials used in the Plasmodium falciparum and Plasmodium vivax immunochromatographic methods of the present invention.

[0026] 1. Preparation of Plasmodium recombinant antigen:

[0027] PCR amplification of Plasmodium falciparum LDH (PfLDH) and Plasmodium vivax LDH (PvLDH) genes

[0028] PCR amplification of PfLDH gene

[0029] Using the genomic DNA of Plasmodium falciparum Hainan strain as a template, the PfLDH gene fragment was amplified by PCR, and the primers were:

[0030] PfLDH-P1: 5'-CCTCGAATTCATGGCACCAAAAGCAAAAATCGT-3' (SEQ NO. 1)

[0031] PfLDH-P2: 5'- CCCTGTCGACTTAAGCTAATGC2CT TCAT TCTCT -3' (SEQ NO.2)

[0032] The reaction was carried out in a 50 ml system. The cycle parameters were denaturation at 93°C for 5 minutes, 50 seconds at 93°C, 45 seconds at 60 seconds at 93°C, 30 cycles ...

Embodiment 2

[0059] Example 2 Colloidal gold rapid immunochromatographic test paper for detection of Plasmodium in the present invention

[0060] 1. Purification and colloidal gold labeling of 1H12 monoclonal antibody

[0061] 1H12 monoclonal antibody ascitic fluid was purified with Protein G Sepharose 4 Fast Flow column (Amersham). The 20-30nm colloidal gold solution was prepared by trisodium citrate reduction method. Adjust the pH value of colloidal gold to 7.2 with 0.1M potassium carbonate, add an appropriate amount of monoclonal antibody 1H12, stir at room temperature for 30 minutes, then add BSA to a final concentration of 1%, and continue stirring at room temperature for 30 minutes; discard the supernatant after high-speed centrifugation, and use 20mmol for precipitation / L TBS (pH 8.2) dissolved and stored at 4°C for later use.

[0062] When making gold label pads, take 2ml of the colloidal gold-antibody conjugate stock solution and dilute to 14ml with diluent. Soak the polyester...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a test strip for rapidly detecting plasmodia based on colloidal gold immunochromatographic assay, as well as antibodies and cell lines thereof. The test strip comprises a basal plate, a sample pad, a polyester cellulose pad, a nitrocellulose membrane and a water absorbent pad, wherein the sample pad, the polyester cellulose pad, the nitrocellulose membrane and the water absorbent pad are partially superposed in sequence along the length direction of the basal plate and fixed on the basal plate; a colloidal gold-antibody I (H12) conjugate coating is sprayed on the polyester cellulose pad; a first test line, a second test line and a quality control line are distributed on the nitrocellulose membrane; the first test line is formed by performing spray-coating on an antibody II (A5) on the nitrocellulose membrane; the second test line is formed by performing spray-coating on an antibody IV (F6) on the nitrocellulose membrane; and the quality control line is formed by performing spray-coating on an goat anti-mouse IgG1 antibody on the nitrocellulose membrane. The test strip provided by the invention is easy to operate, rapid, sensitive and specific, and is applied to the rapid and early-stage diagnosis of malaria.

Description

technical field [0001] The invention relates to the field of biochemistry, in particular to a colloidal gold rapid immunochromatographic detection test paper, an antibody and a cell strain for detecting malaria parasites. Background technique [0002] Malaria is an important vector-borne infectious disease widely prevalent in tropical, subtropical and temperate marginal areas. Malaria has one of the highest morbidity and mortality rates of all vector-borne diseases. At present, there are still more than 90 countries and 2.4 billion people living in malaria endemic areas in the world. Every year, 500 million people get sick and more than 2.5 million die. Ninety percent of cases and deaths are in poor countries in Africa and Asia. According to incomplete statistics, it is estimated that 250,000 to 300,000 people suffer from the disease every year in China. In addition, malaria is also one of the main diseases that cause non-combat attrition of troops entering malaria areas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/20C07K16/20G01N33/569C12R1/91
CPCY02A50/30
Inventor 郝文波李明吴英松徐伟文罗树红王萍廖小青
Owner SOUTHERN MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More