Application of vector with OsMS2 (Oryza sativa L Male Sterile2) gene
A gene and vector technology, applied in the application field of the vector, can solve the problem of undiscovered protein reports and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Obtaining and Morphological Observation of osms2 Mutant Plants
[0053] The mutant is made with 60 Japonica rice 9522 seeds were induced by Coγ-rays at a dose of 280Gy. against mutagenized F 2 A male sterile mutant was backcrossed in three generations, and a stable genetic mutant osms2 regulated by a recessive single gene was obtained. All plant materials were planted at the experimental base of Shanghai Academy of Agricultural Sciences. The osms2 mutant was backcrossed with japonica rice 9522, F 1 All the generations were fertile, and segregation occurred in the self-crossed F2 generation, including 153 normal plants and 49 mutant plants, and the ratio of normal plants to mutant plants was close to 3:1 (χ 2 =0.006,χ 0.05 =3.84), indicating that the phenotype of the male sterile mutant was caused by a recessive mononuclear gene mutation.
[0054] Morphological observation of osms2 mutant plants, such as figure 1 , A, B, C, D, E, wild type on the left; A, B, C, D,...
Embodiment 2
[0056] Mapping and cloning of OsMS2 gene
[0057] (1) Positioning groups. The osms2 mutant was crossed with the indica rice line Guangluai No. 2 In the next generation, the male sterile plants were selected as the positioning group.
[0058] (2) Rice DNA extraction. Using the improved CTAB method. The simple steps are as follows: Take 0.1-0.2 grams (about half a piece) of leaves and put them in a small mortar, add an appropriate amount of liquid nitrogen, grind them to powder immediately, put them into a 2ml centrifuge tube, add 700ul of 1.5xCTAB solution preheated at 100℃ in In a centrifuge tube, mix carefully and place in a 56°C water bath. Take out the centrifuge tube after 20 minutes, add an equal volume of chloroform / isoamyl alcohol, mix vigorously, centrifuge (13000rpm) for 10 minutes, take the supernatant into a new tube, add Mix 900ul of absolute ethanol and place at -20°C for more than half an hour. The precipitated DNA was centrifuged at 14000 rpm (10 minutes). ...
Embodiment 3
[0066] Functional analysis of OsMS2 gene
[0067] In order to further verify the function of this gene, a gene complementation vector pCAMBIA1301-OsMS2 was constructed, and the mutant plants were transformed to observe whether the mutant phenotype could be restored. The primers used were: OsMS2-F: 5'aaaaaaagaattctgacatggcatcaacctgaaca 3' and
[0068] OsMS2-R: 5'aaaaaaactcgagttgcagttcgaaccagctcctag 3'
[0069] Using the genomic DNA of japonica rice 9522 as a template, a fragment of about 6K was amplified by PCR, including the promoter, terminator and full-length of the OsMS2 gene. Carry out enzyme digestion with EcoRI and Xhol restriction endonuclease, connect the pCAMBIA 1301 vector ( Figure 5 ), constructed into pCAMBIA1301-OsMS2.
[0070] Transform the constructed vector into Agrobacterium, infect the young ear callus, transfer to the differentiation medium after two weeks of subculture, and transfer to the rooting medium after the transgenic seedlings appear. After the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More