Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of osgras1 gene related to rice stress resistance, its promoter and application thereof

A rice stress resistance and promoter technology, applied in the field of genetic engineering, can solve the problem of high level of sequence similarity and achieve the effect of improving stress resistance

Inactive Publication Date: 2011-12-14
SHANGHAI AGROBIOLOGICAL GENE CENT
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The PFYRE motif is not as highly conserved as the VHllD and SAW motifs, but in this domain, the sequences exhibit greater synteny, indicating a higher level of sequence similarity among family members

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of osgras1 gene related to rice stress resistance, its promoter and application thereof
  • A kind of osgras1 gene related to rice stress resistance, its promoter and application thereof
  • A kind of osgras1 gene related to rice stress resistance, its promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Expression analysis of rice gene OsGRAS1 under stress conditions

[0040] 1. Drought stress treatment

[0041] Seedling stage: After the IRAT109 seeds germinate, they are grown in hydroponics in the germination box. Nutrient solution (International Rice Institute standard nutrient solution) was applied after the three-leaf stage. The drought treatment was started after the seedlings grew to 4 leaves. A total of 4 drought treatments and controls were set up. The method of drought treatment is to take the seedlings out of the nutrient solution, absorb the water on the root surface with absorbent paper, place it on a clean filter paper, and place it in a growth box (T=28°C, RH=70%, shading) for 30min, 3h , 8h and 20h, then quickly cut the leaves and roots, put them into liquid nitrogen and freeze them, and store them at -80°C for RNA extraction.

[0042] Young panicle differentiation period: use PVC root canal method. The inner diameter of the root canal is 20cm, the ...

Embodiment 2

[0052] Cloning of Rice OsGRAS1 Gene

[0053] 1. Seedling cultivation

[0054] Rice (variety "IRAT109", an upland rice variety introduced from abroad) was collected and preserved in the Germplasm Resource Bank of Shanghai Agricultural Biological Gene Center. The rice was germinated at 35°C for 48 hours, and then sown in the greenhouse until the rice leaves were 3- At 5 slices, it is ready to extract DNA or RNA.

[0055] 2. Isolation of RNA: RNA was extracted according to the method in Example 1.

[0056] 3. Full-length cloning of genes

[0057] The drought resistance-related ESTs in the rice chromosome 4 drought resistance QTL interval (RM241-RM349) were obtained by PlantQTL-GE query. According to the sequence information of one of the ESTs (Geneband accession No: CB096362), a BLAST search was performed on the rice genome and full-length gene database to obtain its corresponding full-length cDNA (AK100784) and predicted gene Loc_Os04g50060. According to the predicted inform...

Embodiment 3

[0061] Rice Gene OsGRAS1 Overexpression Transformed Rice

[0062] 1. Using GATEWAY recombinant cloning technology to construct an overexpression vector containing OsGRAS1 gene:

[0063] Using the pGEMT-Easy vector containing the OsGRAS1 gene of upland rice IRAT109 obtained in Example 1 as a template, the front primer Gf3: 5'AAAAAGCAGGCTATGTTGGATTCTGGTT 3' (SEQ ID NO.10), the back primer Gr3: 5'AGAAAGCTGGGTCTAGTTTGGTTCCCAT 3' (SEQ ID NO.11) for the first round of PCR amplification. Then use the universal primer attB1 adapter: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' (SEQ ID NO.12). attB2adapter: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3 (SEQ ID NO.13) was subjected to the second round of PCR amplification. After the amplified product was recovered and purified, the fragment of the amplified product was cloned into the entry vector pDONR207 by BP reaction, and positive clones were screened. Through the LR reaction, the target gene was recombined and cloned into the GATEWAY overexpression ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an OsGRAS1 gene related to rice stress resistance, its promoter and application thereof. The gene contains the conserved domain of the GRAS gene family and is a member of the SCL type of the gene family. The expression of OsGRAS1 gene is induced by drought, salt and exogenous ABA, and it is related to the stress resistance of rice. The difference in the promoter sequence of OsGRAS1P caused the response time and expression level of the downstream OsGRAS1 gene to be upregulated by drought, salt and exogenous ABA to change. The promoter can be used as a gene regulatory element induced by stress. The rice gene and its promoter of the invention produce obvious response to adversity, and can be applied to stress resistance breeding of plants to improve the stress resistance of plants.

Description

technical field [0001] The invention relates to a gene related to stress resistance of rice, in particular to a new gene OsGRAS1 related to stress resistance of rice, its promoter GRAS1P and its application, belonging to the field of genetic engineering. Background technique [0002] Rice is one of the main food crops in my country. Improving the stress resistance of rice is of great significance to ensure the stability of my country's grain production. Using genetic engineering, a molecular breeding technology, to transfer stress-resistant genes into the currently widely used fine rice varieties, thereby improving their stress resistance, and cultivating new crop varieties that are both stress-resistant and high-yielding is an effective way for rice stress-resistant breeding one. [0003] The use of transcription factors to regulate plant responses to stress is a research hotspot in improving crop stress resistance. Under environmental stress, plants turn on or off certai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/113C12N15/82C12N5/10A01H5/00
Inventor 刘鸿艳丁雪峰罗利军
Owner SHANGHAI AGROBIOLOGICAL GENE CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com