A kind of osgras1 gene related to rice stress resistance, its promoter and application thereof
A rice stress resistance and promoter technology, applied in the field of genetic engineering, can solve the problem of high level of sequence similarity and achieve the effect of improving stress resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Expression analysis of rice gene OsGRAS1 under stress conditions
[0040] 1. Drought stress treatment
[0041] Seedling stage: After the IRAT109 seeds germinate, they are grown in hydroponics in the germination box. Nutrient solution (International Rice Institute standard nutrient solution) was applied after the three-leaf stage. The drought treatment was started after the seedlings grew to 4 leaves. A total of 4 drought treatments and controls were set up. The method of drought treatment is to take the seedlings out of the nutrient solution, absorb the water on the root surface with absorbent paper, place it on a clean filter paper, and place it in a growth box (T=28°C, RH=70%, shading) for 30min, 3h , 8h and 20h, then quickly cut the leaves and roots, put them into liquid nitrogen and freeze them, and store them at -80°C for RNA extraction.
[0042] Young panicle differentiation period: use PVC root canal method. The inner diameter of the root canal is 20cm, the ...
Embodiment 2
[0052] Cloning of Rice OsGRAS1 Gene
[0053] 1. Seedling cultivation
[0054] Rice (variety "IRAT109", an upland rice variety introduced from abroad) was collected and preserved in the Germplasm Resource Bank of Shanghai Agricultural Biological Gene Center. The rice was germinated at 35°C for 48 hours, and then sown in the greenhouse until the rice leaves were 3- At 5 slices, it is ready to extract DNA or RNA.
[0055] 2. Isolation of RNA: RNA was extracted according to the method in Example 1.
[0056] 3. Full-length cloning of genes
[0057] The drought resistance-related ESTs in the rice chromosome 4 drought resistance QTL interval (RM241-RM349) were obtained by PlantQTL-GE query. According to the sequence information of one of the ESTs (Geneband accession No: CB096362), a BLAST search was performed on the rice genome and full-length gene database to obtain its corresponding full-length cDNA (AK100784) and predicted gene Loc_Os04g50060. According to the predicted inform...
Embodiment 3
[0061] Rice Gene OsGRAS1 Overexpression Transformed Rice
[0062] 1. Using GATEWAY recombinant cloning technology to construct an overexpression vector containing OsGRAS1 gene:
[0063] Using the pGEMT-Easy vector containing the OsGRAS1 gene of upland rice IRAT109 obtained in Example 1 as a template, the front primer Gf3: 5'AAAAAGCAGGCTATGTTGGATTCTGGTT 3' (SEQ ID NO.10), the back primer Gr3: 5'AGAAAGCTGGGTCTAGTTTGGTTCCCAT 3' (SEQ ID NO.11) for the first round of PCR amplification. Then use the universal primer attB1 adapter: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3' (SEQ ID NO.12). attB2adapter: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3 (SEQ ID NO.13) was subjected to the second round of PCR amplification. After the amplified product was recovered and purified, the fragment of the amplified product was cloned into the entry vector pDONR207 by BP reaction, and positive clones were screened. Through the LR reaction, the target gene was recombined and cloned into the GATEWAY overexpression ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
