Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice rhizoctonia solani effector gene AG1IA06910 and application thereof

A technology of AG1IA06910 and Rhizoctonia solani, applied in the field of genetic engineering, can solve problems such as the unclear action site of Rlm resistance gene, and achieve the effect of controlling the occurrence of sheath blight

Inactive Publication Date: 2013-08-07
SICHUAN AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although it is clear that they have avirulent activity, the mechanism of AvrLm recognition, the corresponding Rlm resistance genes and their sites of action remain unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice rhizoctonia solani effector gene AG1IA06910 and application thereof
  • Rice rhizoctonia solani effector gene AG1IA06910 and application thereof
  • Rice rhizoctonia solani effector gene AG1IA06910 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Cloning of predicted effector genes

[0038] The AG1IA strain was isolated and purified from rice sheath blight diseased plants by the Rice Institute of Sichuan Agricultural University. It is a common fungal strain on rice plants and is widely distributed in rice cultivation areas. (AG1IA strain has been published in Sichuan Agricultural University, master's thesis, analysis of different proteins induced by Rhizoctonia solani AG1IA in maize, author Li Yun)

[0039] Under the ultra-clean workbench, use tweezers to pick a small amount of AG1IA mycelium, put it into 50ml PDA medium, mash the mycelium, culture at 28°C, 200r / m for two days, and collect the mycelium by filtering with four layers of gauze. Total RNA was extracted by triturating with liquid nitrogen. Using oligodT as a primer, cDNA was obtained by reverse transcription. Primers were designed according to the predicted sequence as follows:

[0040] 5'ATGTGCAGCGCACTTGTGTCCAGACCATGTGATA AGATCTGG3'

...

Embodiment 2

[0042] Embodiment 2: Construction, transformation and expression of effector gene prokaryotic expression vector

[0043] The electrophoresis detection of the target gene obtained by PCR has no bands, and the target gene can be connected to the expression vector pEASY-E1 according to the instructions of TransGen Biotech Peasy-E1kit. The sequenced gene AG1IA06910 is exactly the same as the predicted sequence, and the base sequence is as shown in SEQ ID NO .1 shown. The transformation conditions are the same as the conventional E. coli transformation conditions. Positive transformants are picked, cultured at 37°C until the OD value is 0.6, then transferred to 28°C, induced by IPTG1mM for 7 to 11 hours, and the effector protein is expressed. SDS-PAGE detection picture of expressed protein image 3 .

Embodiment 3

[0044] Embodiment 3: Pathogenicity detection of expressed protein

[0045] Collect the cells expressing AG1IA06910 and ultrasonically crush to obtain crude protein. Be careful not to denature the protein during the crushing process (the crushing time is preferably 5 seconds, the power should not exceed 200W, and the sample is always kept in an ice bath during the crushing process). Select rice leaves at the three-leaf stage cultivated in a greenhouse with consistent growth, and place them in a sterilized petri dish with two layers of filter paper built in to keep the filter paper moist to keep the leaves moist. Use a sterilized toothpick to make a small hole in the center of the rice leaf, cover the small hole with three layers of sterilized 0.5cm×0.5cm filter paper, and inoculate 50 microliters of crude protein. The infected leaves were placed in a light incubator at 28 degrees Celsius, with light for 12 hours, dark for 12 hours, and RH (disease index) 80%. Observe the disea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rice rhizoctonia solani effector gene AG1IA06910 and application thereof. The rice rhizoctonia solani effector gene AG1IA06910 has a nucleotide sequence shown in the formula of SEQ ID NO.1. Results of the research on the rice rhizoctonia solani effector gene AG1IA06910 show that in practice, a molecular target of a novel pesticide can be designed according to a structure and functions of the rice rhizoctonia solani effector gene AG1IA06910; a receptor protein gene of an effector protein of host cell such as a rice cell and the like can be knocked out or be subjected to mutation so that a breed with lasting disease resistance is obtained; the rice rhizoctonia solani effector gene AG1IA06910 is conducive to establishing of a molecular detection system for detecting pathogenic variation of a natural rhizoctonia solani colony, research of the distribution of the rice rhizoctonia solani effector gene AG1IA06910 in a natural colony of a field, and revealing of composition and variation of microspecies of a rhizoctonia solani colony, is also conducive to disease resistance identification, reasonable distribution and rotation of rice, and is convenient for effective control of banded sclerotial blight.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a Rhizoctonia solani effector gene AG1IA06910 and an application thereof. Background technique [0002] Rice sheath blight caused by Rhizoctonia solani is a fungal disease, and it is one of the three major rice diseases along with rice blast and bacterial blight. Rhizoctonia solani can infect a wide range of crops, including rice, corn, wheat, potatoes, pastures, soybeans, etc. Rhizoctonia solani can cause so many crop diseases is closely related to its secretion of effector (effector factor) molecules. This molecule can modulate host innate immunity and enhance parasitic infection. These effectors are now generally recognized as key pathogenic determinants of enhanced parasitic infection (Kamoun, 2007; Hogenhout et al., 2009). [0003] Rhizoctonia solani closely associates with its host plant and precisely manipulates plant cells by secreting effector molecules. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C07K14/37C12N15/63C12N1/21C12N5/10C12Q1/68C12N15/09A01H5/00C12R1/645
Inventor 郑爱萍李平张丹华朱军邓其明李双成王世全
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com