Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof

A recombinant lentivirus, RNA interference technology, applied in the field of molecular biology, can solve the problem that non-viral vectors cannot meet the long-term expression and other problems

Inactive Publication Date: 2012-08-22
CHANGSHU CHANGFU ORGANIC COMPOUND FERTILIZER
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the vectors for gene therapy mainly include non-viral vectors and viral vectors. However, non-viral vectors cannot satisfy long-term expression, and this defect is undoubtedly filled by viral vectors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof
  • Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof
  • Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Construction of lentiviral vector for gene hUHRF1

[0056] 1. Design and synthesis of oligonucleotides

[0057] Using Invitrogen's online RNAi series design software BLOCK-iT RNAi Designer, design 4 interference target sequences (see the table below) for hUHRF1 gene mRNA sequence (NM_001048201), and synthesize corresponding double-stranded DNA (Shanghai Sangon Bioengineering Technology Co., Ltd. Services Ltd). The loop structure in the LV3-shRNA template uses TTCAAGAGA to avoid the formation of termination signals. GATCC was added to the 5' end of the sense strand template, which was complementary to the sticky end formed after digestion with BamHI; AATTC was added to the 5' end of the antisense strand template, which was complementary to the sticky end formed after EcoRI digestion.

[0058] serial code

sequence name

target sequence

U401

hUHRF1-homo-704

AGGAGGACGTCATTTACCATT

U402

hUHRF1-homo-1615

GGTCGAGATC...

Embodiment 2

[0102] Example 2: Encapsulation of hUHRF1 gene RNA interference recombinant lentivirus

[0103] Take the recombinant virus plasmid pGCSIL-sh-hUHRF1 (20 μg) prepared by high-purity endotoxin-free extraction, helper plasmids pHelper 1.0 (15 μg) and pHelper 2.0 (10 μg), and co-transfect 293T cells according to the instructions of Invitrogen Lipofectamine 2000 .

[0104] 8 hours after transfection, replace with complete medium, at 37°C, 5% CO 2 After continuing to culture in the incubator for 48 hours, the cell supernatant rich in lentiviral particles was collected. Centrifuge at 4000g for 10 minutes at 4°C to remove cell debris and filter the supernatant with a 0.45 μM filter to obtain lentivirus for use, which can meet general cell experiments. If you want to obtain a higher concentration of lentivirus, you can further concentrate and purify it to obtain a high-titer lentivirus concentrate. Pack the virus concentrate and store it at -80°C for a long time. Take one of them and ...

Embodiment 3

[0114] Example 3: Target cell invasion test and gene expression inhibition effect analysis

[0115] 1. Target cell invasion test

[0116] Human breast cancer cell MCF-7 (purchased from the Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) was subjected to virus infection experiment according to the following steps:

[0117] 1) When MCF-7 cells are cultured to 80-90% confluence in a 10 cm culture dish, the culture medium is poured off, and the cells are washed twice with 3 ml of D-Hank's solution.

[0118] 2) Add 1ml of Trypsin-EDTA solution (0.05%, Gibco), mix well, carefully suck off the trypsin solution, and place it at 37°C for 3-5 minutes.

[0119] 3) Add 2ml of DMEM culture medium and pipette to make the cells form a single-cell suspension.

[0120] 4) Count on a blood cell counting board, according to 10×10 5 Inoculate a 6-well plate at the concentration of cells / well and mix well at 37°C 5% CO 2 Incubate for 24 hours.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof. The lentiviral vector aiming at ShRNA of the hUHRF1 gene is experimentally constructed; a synthetic DNA (Deoxyribonucleic Acid) segment aiming at the ShRNA is mediated through the lentiviral vector, and is in cotransfection 293 T cell culture with two vectors of pHelper 1.0 and pHelper 2.0; and after the recombinant lentiviral vector is obtained, a target cell is cotransfected, so that RNA interference aiming at the hUHRF1 gene is realized. The adopted inactive third-generation lentiviral vector (SIN) has the advantages of safety, reliability, capability of infecting nondividing cells, long-duration expression of integrating target genes into target cell gene groups, small immune reaction and the like, and is an ideal vector. According to the lentiviral vector, the interference effect on human breast cancer cells MCF-7 reaches 70-85 percent, so that the recombinant lentiviral vector lays a good experimental foundation for further research of relevant hUHRF1 genes, and can be widely used for in vivo gene treatment and gene function research.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology, biomedicine and genetic engineering, and mainly relates to an RNA interference recombinant lentiviral vector (LV-sh-hUHRF1) targeting hUHRF1 (human ubiquitin-like protein containing PHD and RING domain 1) gene and its preparation . Background technique [0002] The occurrence and development of tumors are caused by multiple factors, multi-step and multi-stage development process, genome instability or changes in the number of chromosomes (aneuploidy), chromosomal translocation, gene amplification, etc. are cancerous cells important features. The latest research found that about 350 genes among about 25,000 genes in the human genome are oncogenes. Only a very small part of the functions have been studied, and most of the genes with unknown functions need further research. [0003] The hUHRF1 gene is located on human chromosome 19p13.3, consisting of 2,327 bp, containing 18 exons, a 2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/113C12N15/66
Inventor 殷浩金
Owner CHANGSHU CHANGFU ORGANIC COMPOUND FERTILIZER
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More