Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof
A recombinant lentivirus, RNA interference technology, applied in the field of molecular biology, can solve the problem that non-viral vectors cannot meet the long-term expression and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Construction of lentiviral vector for gene hUHRF1
[0056] 1. Design and synthesis of oligonucleotides
[0057] Using Invitrogen's online RNAi series design software BLOCK-iT RNAi Designer, design 4 interference target sequences (see the table below) for hUHRF1 gene mRNA sequence (NM_001048201), and synthesize corresponding double-stranded DNA (Shanghai Sangon Bioengineering Technology Co., Ltd. Services Ltd). The loop structure in the LV3-shRNA template uses TTCAAGAGA to avoid the formation of termination signals. GATCC was added to the 5' end of the sense strand template, which was complementary to the sticky end formed after digestion with BamHI; AATTC was added to the 5' end of the antisense strand template, which was complementary to the sticky end formed after EcoRI digestion.
[0058] serial code
sequence name
target sequence
U401
hUHRF1-homo-704
AGGAGGACGTCATTTACCATT
U402
hUHRF1-homo-1615
GGTCGAGATC...
Embodiment 2
[0102] Example 2: Encapsulation of hUHRF1 gene RNA interference recombinant lentivirus
[0103] Take the recombinant virus plasmid pGCSIL-sh-hUHRF1 (20 μg) prepared by high-purity endotoxin-free extraction, helper plasmids pHelper 1.0 (15 μg) and pHelper 2.0 (10 μg), and co-transfect 293T cells according to the instructions of Invitrogen Lipofectamine 2000 .
[0104] 8 hours after transfection, replace with complete medium, at 37°C, 5% CO 2 After continuing to culture in the incubator for 48 hours, the cell supernatant rich in lentiviral particles was collected. Centrifuge at 4000g for 10 minutes at 4°C to remove cell debris and filter the supernatant with a 0.45 μM filter to obtain lentivirus for use, which can meet general cell experiments. If you want to obtain a higher concentration of lentivirus, you can further concentrate and purify it to obtain a high-titer lentivirus concentrate. Pack the virus concentrate and store it at -80°C for a long time. Take one of them and ...
Embodiment 3
[0114] Example 3: Target cell invasion test and gene expression inhibition effect analysis
[0115] 1. Target cell invasion test
[0116] Human breast cancer cell MCF-7 (purchased from the Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) was subjected to virus infection experiment according to the following steps:
[0117] 1) When MCF-7 cells are cultured to 80-90% confluence in a 10 cm culture dish, the culture medium is poured off, and the cells are washed twice with 3 ml of D-Hank's solution.
[0118] 2) Add 1ml of Trypsin-EDTA solution (0.05%, Gibco), mix well, carefully suck off the trypsin solution, and place it at 37°C for 3-5 minutes.
[0119] 3) Add 2ml of DMEM culture medium and pipette to make the cells form a single-cell suspension.
[0120] 4) Count on a blood cell counting board, according to 10×10 5 Inoculate a 6-well plate at the concentration of cells / well and mix well at 37°C 5% CO 2 Incubate for 24 hours.
...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com