Method for recombination-mediated escherichia coli genome point mutation

A technology of Escherichia coli and genome, applied in the field of genetic engineering, can solve the problems of long homologous fragments, difficulty in popularization and application, and time-consuming, etc., and achieve the effect of high efficiency and good economic prospects

Inactive Publication Date: 2012-10-03
NANJING NORMAL UNIVERSITY
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that the shortcomings of these two classic methods are: 1. Because the required homologous fragment is long (generally 1kb), it requires cumbersome and time-consuming gene cloning steps; 2. Occurs in the final strain The proportion of mutations may vary greatly, that is, more clones need to be screened to obtain the correct mutant strain
Therefore, the method of mutating oligonucleotides is only of basic research significance at present, and it is difficult to be popularized and applied at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for recombination-mediated escherichia coli genome point mutation
  • Method for recombination-mediated escherichia coli genome point mutation
  • Method for recombination-mediated escherichia coli genome point mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Construction of the vector

[0043] 1. Construction of recombinant enzyme and I-SceI expression vector

[0044] Design primers IPM1: 5'-GGGATGCATTTAAGACCACTTTCACATTTAAG-3', (SEQ ID NO.1); IPM2: 5'-GGGATGCATTTATTTCAGGAAAGTTTCGGAG-3', (SEQ ID NO.2). Using pST98-AS as a template, IPM1 and IPM2 were amplified to obtain a 1.4kb tetR-ptetA-I-SceI fragment. The 1.4kb fragment was digested with NsiI and cloned into the NsiI site of pBAD322 to obtain a recombinant clone pLS133.

[0045] Design primers IPM3: 5'-GGGCCATGGATTAATACTGAAACTG-3', (SEQ ID NO.3); IPM4: 5'-GGGCTCGAGCTATCGCCATTGCTCCCCAAATAC-3', (SEQ ID NO.4). Using HindIII-digested lambda phage DNA (purchased from Dalian Bao Biological Co., Ltd.) as a template, IPM3 and IPM4 were amplified to obtain a 1.9kb red gene fragment, which was digested with NcoI and XhoI and cloned into the NcoI and SaII positions of pLS133 Click to obtain the target clone pLS134. XhoI and SaII are homologous enzymes, which can be l...

Embodiment 2

[0049] Example 2 The 70th base C in the open reading frame of the lacZ gene is mutated to T

[0050]1. Preparation and transformation of Escherichia coli competent cells expressing the Red recombinase gene

[0051] pLS134 was transformed into MG1655 and selected for resistance to ampicillin containing 50 μg / ml. Inoculate the single colony of the obtained bacterial strain into 3ml LB liquid medium, shake overnight at 37°C, transfer to 50ml LB with 1 / 50 volume, and shake and cultivate until the cell OD 600 At about 0.2, add L-arabinose at a final concentration of 0.15% to induce recombinase, and continue culturing until OD 600 About 0.4, pour the bacterial solution into a pre-cooled centrifuge tube, ice bath for 10 minutes, centrifuge at 5000rpm for 5 minutes at 4°C, and discard the supernatant. The precipitate was washed twice with ice-cold 10% glycerol, and finally suspended in 200 μl ice-cold 10% glycerol, 50 μl per tube.

[0052] Add the DNA dissolved in double distilled ...

Embodiment 3

[0061] Example 3 The 574-576th base GAA of the open reading frame of the nanA gene is mutated into AAC

[0062] In this embodiment, the target site is the 574th-576th base GAA of the open reading frame of the nanA gene, and the mutation site is AAC, that is, GAA is mutated into AAC.

[0063] Design primer R1171: 5'- AACAAATAGGGGTTCCGCGC -3', (SEQ ID NO.15), in this primer, the 50bp homology arm upstream of the target site is indicated by lowercase letters, the mutation site is indicated by bold letters, and the 30bp homology fragment downstream of the target site is indicated by The italic letters indicate that the amplification primers are underlined; R1172: 5'-GTACTGCCGATACCACCATCAGC TTCCTATTCCGAAG -3', (SEQ ID NO.16), in this primer, the reverse complementary sequence of 20 bp downstream of the 30 bp homologous fragment downstream of the target site is indicated by regular letters, and the reverse complement of the 30 bp homologous fragment downstream of the targ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for recombination-mediated escherichia coli genome point mutation, which is realized as follows: a modified fragment is obtained through overlapping-extending polymerase chain reaction, wherein two 50bp homologous arms are located at two ends of the modified fragment and are consistent with two sides of a target site in sequence, and further, the middle part of the homologous arm comprises a mutation site, a 30bp homologous fragment consistent with downstream sequences of the target site, and a kanamycin resistance gene with two homing nuclease I-SceI enzyme cutting sites on two sides; and then, the fragments between the two 50bp homologous arms are integrated to a colon bacillus genome, the mutation site replaces the target site on the genome, and a kanamycin resistance mutant strain is obtained. Subsequently, heat-inactivated chlorotetracycline induces the expression of the I-SceI enzyme, and catalyze the 30bp homologous fragment to undertake homologous recombination with the 30bp homologous fragment downstream the target site, as a result, the 30bp homologous fragments, the two I-SceI enzyme cutting sites and the kanamycin resistance gene are eliminated, and a colon bacillus mutant strain with point mutation can be obtained.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for efficiently utilizing recombinant engineering means to realize point mutations in Escherichia coli genome. Background technique [0002] Escherichia coli is the most thoroughly studied microbial strain in genetics and is widely used in basic research in biology. Escherichia coli is also one of the most important microbial strains in industrial production, and is the preferred strain for synthetic biology and metabolic engineering. Escherichia coli is widely used in the production of pharmaceuticals, fine chemical products, and enzymes with industrial catalytic value. These actual functions are closely related to the genes on the genome, so elucidating the functions of these genes and improving the quality of these genes are important ways to exert the functions of E. coli. Among many research methods, the point mutation of the genome (that is, the point mutation ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/63
Inventor尚广东蒋伏欢张飞飞石牡丹
OwnerNANJING NORMAL UNIVERSITY