Unlock instant, AI-driven research and patent intelligence for your innovation.

TRPCR (template-ready polymerase chain reaction) detection method of RNA (ribonucleic acid)

A detection method and purpose technology, applied in the direction of fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of influence, limited sensitivity, cumbersome steps, etc.

Active Publication Date: 2013-10-30
ZHEJIANG JFK BIOLOGICAL TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The two-tube method is relatively common. In the two-tube method RT-PCR, each step can be carried out under the best conditions as much as possible. However, because the RT system contains PCR inhibitors, generally only about 5% of the RT product can be taken out for PCR. , which limits the sensitivity of the final assay, but is useful when using one sample to detect multiple target RNAs—since one RT product can be used separately for many PCR reactions
In one-tube RT-PCR, RT and PCR are carried out in one tube, and conditions optimized for both reverse transcription and PCR must be provided as much as possible. One-step RT-PCR is easy to operate when processing a large number of samples and helps to reduce residual Contamination, as there is no need to uncap the tube between cDNA synthesis and amplification. Successful optimization of the one-step method can result in higher sensitivity, down to 0.1 pg total RNA, because the entire cDNA sample is amplified – theory The upper sensitivity can be increased by 20 times compared with the two-tube method. However, it is difficult to control the conditions optimized for one-step RT-PCR, which often leads to serious non-specific amplification, and the cost is greatly increased.
[0004] Although RT-PCR has a high degree of promotion and popularity in the field of scientific research, there is still a lot of room for improvement in clinical detection applications. The main problems include: cumbersome steps and high requirements for operations, especially the two enzymatic reactions (RT-PCR The optimal reaction conditions of PCR and PCR are different, and they are easily affected by various inhibitory substances, non-specific amplification and false positives. Finally, the price of reverse transcriptase remains high, and the operation cost is very difficult. come down.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TRPCR (template-ready polymerase chain reaction) detection method of RNA (ribonucleic acid)
  • TRPCR (template-ready polymerase chain reaction) detection method of RNA (ribonucleic acid)
  • TRPCR (template-ready polymerase chain reaction) detection method of RNA (ribonucleic acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1: washing removes non-fixed probe B

[0048] Probe B for detection of hTERT mRNA:

[0049] 5'-CAGGAGCAGCATTCCATCACGCTCCTTCAGGCAGGACACCTGGCGGAAGGAGGGGGCCGTCGCAGGTCCAGAGAAGG-3', the shaded part is the complementary sequence binding to mRNA,

[0050] Both ends are PCR primer sequences. PCR primers: TAB1: CAGGAGCAGCATTCCATCACG, TAB2: CCTTCTCTGGACCTGCGACG.

[0051] Human lung cancer cell line A549 cells were cultured in a 24-well plate, 1000 cells / well, after overnight culture, the culture medium was aspirated, +200ul lysate B (the concentration of probe B added to the lysate was 1nmol / L), repeated Pipette, transfer to a 1.5m1 centrifuge tube, place on ice for 20min, 4. C. Centrifuge at 15000rpm for 20min, take the supernatant, and obtain the cell lysate supernatant; the composition of lysate B is as follows: 1%SDS, 500mmol / LNaCl, 2mmol / LMgCl 2 , 10mmol / L2-mercaptoethanol, 0.1mg / ml protamine DNA (Sigma company), 0.1%Tween201% skimmed milk powder, 1nmol / L prob...

Embodiment 2

[0058] Example 2: Fabrication of anchor tubes by magnetic bead method

[0059] Probe A for anchoring hTERT mRNA: 5'-GACTCAGCTGCGTCTGGGCTGTCCTGAGTGACCCCA. TBST buffer 20ul, containing 10ug M-280 streptavidin magnetic beads and 2pmol biotinylated probe A (biotinylated probe A is directly modified and added to the 5' end during synthesis), put into a 0.2ml PCR thin-walled tube, At room temperature for 1 hour, use a magnet to adsorb the magnetic beads on the tube wall, blot the liquid in the tube, add 50ul TBST buffer, mix well, blot dry, repeat this way for a total of 6 times, and finally blot dry; add 50ul TE buffer for later use.

[0060] Cell lysis: Cell culture in 24-well plate, absorb culture medium, + 200ul lysate B (same as Example 1), pipette repeatedly, transfer to 1.5ml centrifuge tube, put on ice for 20min, centrifuge at 4°C, 15000rpm for 20min, take supernatant to obtain cell lysate supernatant. Then use a magnet to adsorb the magnetic beads on the tube wall, blot...

Embodiment 3

[0064] Example 3: direct PCR in-tube coupling to make anchor tubes

[0065] 50ul of TBST buffer, containing 5pmol biotinylated hTERT probe A (see Example 2), put into a streptavidin-coated 0.2ml PCR thin-wall tube, room temperature for 1hr, blot the liquid in the tube, add 100ul TBST buffer, mix well, blot dry, wash repeatedly in this way for a total of 3 times, and finally blot dry; add 100ul TE buffer, then blot the liquid in the tube, add 50ul cell lysate supernatant (same as Example 1), 64°C Incubate for 10 minutes, then blot the liquid in the tube, wash 7 times with TBST buffer, add 50ul PCR reaction solution (SYBR fluorescence quantification), and perform PCR program (pre-denaturation at 93°C for 3min, then 40 cycles of 93°C for 3s, 62°C for 30s , two-step method), SYBR fluorescence quantitative analysis. Using this method, 10-10,000 A549 cells can be detected, and positive results can be obtained (the Ct value of the supernatant of the cell lysate is less than the Ct va...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a TRPCR (template-ready polymerase chain reaction) detection method of RNA (ribonucleic acid). Compared with the traditional RT-PCR (reverse transcription-polymerase chain reaction) method, the method provided by the invention does not require RNA purification and extraction, omits reverse transcription reaction, and shortens the PCR pretreatment process from the original more than 3 hours to about 50 minutes. Thus, the method provided by the invention is simple to operate and quick and easy to implement, has high RNA detection sensitivity and specificity, and is suitable for the detection of RNA obtained by cracking a sample from any source.

Description

(1) Technical field [0001] The invention relates to a RNA preparation template PCR (Template-Ready PCR, TRPCR) detection method. (2) Background technology [0002] RNA is the carrier of genetic information transmission. RT-PCR (reverse transcription reverse transcription-polymerase chain reaction), refers to the method of combining reverse transcription (Reverse Transcription, RT) and PCR (Polymerase Chain Reaction) reactions. RT-PCR will use RNA as a template for cDNA Synthesis, or RT, combined with PCR provides a fast and sensitive method for analyzing gene expression. RT-PCR detection or quantitative analysis of RNA is more sensitive and easier to operate than other RNA analysis techniques including Northern blotting, RNase protection analysis, in situ hybridization and S1 nuclease analysis. Detection and analysis, detection and analysis of pathogens and other powerful means. [0003] The template for RT-PCR can be total RNA or poly(A)+RNA. RT requires reverse transcri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor 陈燃伍迪金晓铮
Owner ZHEJIANG JFK BIOLOGICAL TECH