TRPCR (template-ready polymerase chain reaction) detection method of RNA (ribonucleic acid)
A detection method and purpose technology, applied in the direction of fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of influence, limited sensitivity, cumbersome steps, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Embodiment 1: washing removes non-fixed probe B
[0048] Probe B for detection of hTERT mRNA:
[0049] 5'-CAGGAGCAGCATTCCATCACGCTCCTTCAGGCAGGACACCTGGCGGAAGGAGGGGGCCGTCGCAGGTCCAGAGAAGG-3', the shaded part is the complementary sequence binding to mRNA,
[0050] Both ends are PCR primer sequences. PCR primers: TAB1: CAGGAGCAGCATTCCATCACG, TAB2: CCTTCTCTGGACCTGCGACG.
[0051] Human lung cancer cell line A549 cells were cultured in a 24-well plate, 1000 cells / well, after overnight culture, the culture medium was aspirated, +200ul lysate B (the concentration of probe B added to the lysate was 1nmol / L), repeated Pipette, transfer to a 1.5m1 centrifuge tube, place on ice for 20min, 4. C. Centrifuge at 15000rpm for 20min, take the supernatant, and obtain the cell lysate supernatant; the composition of lysate B is as follows: 1%SDS, 500mmol / LNaCl, 2mmol / LMgCl 2 , 10mmol / L2-mercaptoethanol, 0.1mg / ml protamine DNA (Sigma company), 0.1%Tween201% skimmed milk powder, 1nmol / L prob...
Embodiment 2
[0058] Example 2: Fabrication of anchor tubes by magnetic bead method
[0059] Probe A for anchoring hTERT mRNA: 5'-GACTCAGCTGCGTCTGGGCTGTCCTGAGTGACCCCA. TBST buffer 20ul, containing 10ug M-280 streptavidin magnetic beads and 2pmol biotinylated probe A (biotinylated probe A is directly modified and added to the 5' end during synthesis), put into a 0.2ml PCR thin-walled tube, At room temperature for 1 hour, use a magnet to adsorb the magnetic beads on the tube wall, blot the liquid in the tube, add 50ul TBST buffer, mix well, blot dry, repeat this way for a total of 6 times, and finally blot dry; add 50ul TE buffer for later use.
[0060] Cell lysis: Cell culture in 24-well plate, absorb culture medium, + 200ul lysate B (same as Example 1), pipette repeatedly, transfer to 1.5ml centrifuge tube, put on ice for 20min, centrifuge at 4°C, 15000rpm for 20min, take supernatant to obtain cell lysate supernatant. Then use a magnet to adsorb the magnetic beads on the tube wall, blot...
Embodiment 3
[0064] Example 3: direct PCR in-tube coupling to make anchor tubes
[0065] 50ul of TBST buffer, containing 5pmol biotinylated hTERT probe A (see Example 2), put into a streptavidin-coated 0.2ml PCR thin-wall tube, room temperature for 1hr, blot the liquid in the tube, add 100ul TBST buffer, mix well, blot dry, wash repeatedly in this way for a total of 3 times, and finally blot dry; add 100ul TE buffer, then blot the liquid in the tube, add 50ul cell lysate supernatant (same as Example 1), 64°C Incubate for 10 minutes, then blot the liquid in the tube, wash 7 times with TBST buffer, add 50ul PCR reaction solution (SYBR fluorescence quantification), and perform PCR program (pre-denaturation at 93°C for 3min, then 40 cycles of 93°C for 3s, 62°C for 30s , two-step method), SYBR fluorescence quantitative analysis. Using this method, 10-10,000 A549 cells can be detected, and positive results can be obtained (the Ct value of the supernatant of the cell lysate is less than the Ct va...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 