Anti-tetanotoxin antibody, and preparation method and application thereof

An anti-tetanus and antibody technology, applied in the direction of botany equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of no practical application value, side effects and large acceptance by blood donors, and achieve high affinity and preparation The method is simple and the application prospect is broad

Active Publication Date: 2013-01-16
CHENGDU RONGSHENG PHARMA
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The former will produce a series of side effects when injected into the human body, and the latter is a specific immunoglobulin preparation prepared by separating and purifying the plasma of healthy people after being immunized with tetanus toxoid. The limitation of the method, and the risk of blood-borne virus infection and the side effects of toxoid immunization in this method are not easy to be accepted by blood donors, and have no practical application value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-tetanotoxin antibody, and preparation method and application thereof
  • Anti-tetanotoxin antibody, and preparation method and application thereof
  • Anti-tetanotoxin antibody, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Preparation of antibody of the present invention

[0032] 1. Human immune antibody library construction

[0033] The peripheral blood of 5 healthy adults with high neutralization titer immunized with purified tetanus toxoid was collected by conventional method, and the mononuclear cells were separated;

[0034] Total RNA was extracted with Trizol, and single-stranded cDNA was synthesized by reverse transcription according to the M-Mulv-RT reagent instructions, and used as a template to PCR amplify the light and heavy chain genes of different families with the following primers;

[0035] KI-5'ACCGGAGAGCTCCAGATGACCCAGTCTCCA.

[0036] KII-5'ACCGGAGAGCTCGTGWTGACYCAGTCTCCA.

[0037] The above two primers are primers at the 5' end of the light chain, and the underline is the SacI restriction site.

[0038] K-3'GCGCCGTCTAGAACTAACACTTCCCCCCTGTTGAAGCTCTTTGTGACGGGCAAG.

[0039] The above primers are primers for the 3' end of the light chain, and the underline i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an anti-tetanotoxin antibody. In the heavy chain variable region, the amino acid sequence of CDR1 is disclosed as SEQ ID NO.5, the amino acid sequence of CDR2 is disclosed as SEQ ID NO.6, and the amino acid sequence of CDR3 is disclosed as SEQ ID NO.7; and in the light chain variable region, the amino acid sequence of CDR1 is disclosed as SEQ ID NO.8, the amino acid sequence of CDR2 is disclosed as SEQ ID NO.9, and the amino acid sequence of CDR3 is disclosed as SEQ ID NO.10. The invention also discloses a nucleotide sequence for coding the anti-tetanotoxin antibody, and a corresponding recombinant plasmid and recombinant expression vector. The invention also discloses a preparation method and application of the anti-tetanotoxin antibody. The anti-tetanotoxin antibody disclosed by the invention is a full human antibody, has the advantages of low side reaction, high affinity and simple preparation method, and has wide industrial application prospects.

Description

technical field [0001] The invention relates to an antibody, in particular to an anti-tetanus toxin antibody, and belongs to the field of biotechnology. Background technique [0002] Tetanus is an infectious disease caused by Bacillus tetani, with a high mortality rate. Bacillus tetani widely exists in soil, dust, rust, etc., and it is easy to cause infection with open wounds and neonatal trauma. When infected by bacillus tetanus, the bacteria multiply in the body and release tetanus toxin, which combines with nerve cells, causing severe neurological symptoms, and the patient suffers unbearable pain and soon dies. There are two treatment methods for tetanus, one is to inject tetanus toxoid for active immunization, and the other is to inject tetanus antitoxin (antibody) for passive immunization. the most effective treatment measures. [0003] Currently, the antibody products on the market for tetanus treatment include the first generation of animal-derived antiserum and th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/12C12N15/13C12N15/63C12N5/10C12P21/02A61K39/08A61P31/04
Inventor何太平聂艳桃唐菁燕杨波宋春雷伍立恒
OwnerCHENGDU RONGSHENG PHARMA