High selectivity gene mutation detection method, high selectivity gene mutation detection primer and primer design method

A technology with high selectivity and detection method, applied in DNA/RNA fragments, DNA preparation, recombinant DNA technology, etc., can solve the problems of high cost, difficult synthesis of MGB probes, unfavorable wide application, etc., and achieve high selectivity, Low cost, high sensitivity effect

Inactive Publication Date: 2013-01-16
XIAMEN JIKE BIOTECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the synthesis of MGB probes is difficult and expensive, which is not conducive to wide application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High selectivity gene mutation detection method, high selectivity gene mutation detection primer and primer design method
  • High selectivity gene mutation detection method, high selectivity gene mutation detection primer and primer design method
  • High selectivity gene mutation detection method, high selectivity gene mutation detection primer and primer design method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Select SNP (rs13182883) as the research object, its genotype A is the wild type, and the genotype G is the mutant type, and the corresponding primers and probes are designed as follows:

[0028] Primer F: TGAGGATTTG CTGGCCTGCAGTGAGCATT

[0029] Primer R: CTGACAATCCTTGGTCTGCT

[0030] Detection probe: FAM-GAAGAAAGTAACGGAGAGCCTG-BHQ

[0031] In order to investigate the specificity of the method, homozygous wild template 1 was serially diluted 10 times to obtain wild-type templates with concentrations of 1000 copies / μL, 100 copies / μL, 10 copies / μL, and 1 copy / μL; Method sensitivity, 10-fold gradient dilution of homozygous mutant template 2 to obtain mutant templates at concentrations of 1000 copies / μL, 100 copies / μL, 10 copies / μL, and 1 copy / μL.

[0032] 25 μL PCR reaction system contains 5 μL human genome template, 75 mmol / L Tris-HCl pH 9.0, 20 mmol / L (NH4) 2SO4 , 0.01% Tween 20, 50 mmol / L KCl, 1 U hot start Taq enzyme, 3.5 mmol / L Mg2+, 0.2 μmol / L detection probe, 0.0...

Embodiment 2

[0035] The incorporation experiment for simulating the detection of rare mutant templates is as follows: dilute a group of mutant templates with concentrations of 2000 copies / μL, 200 copies / μL, 20 copies / μL, and 2 copies / μL, and mix the mutant templates with In an equal volume of the wild-type template at a concentration of 2000 copies / μL, the ratios of mutant and wild-type templates were 1:1, 1:10, 1:100, and 1:1000, respectively.

[0036] 25 μL PCR reaction system contains 5 μL human genome template, 75 mmol / L Tris-HCl pH 9.0, 20 mmol / L (NH4) 2SO 4 , 0.01% Tween 20, 50 mmol / L KCl, 1 U hot start Taq enzyme, 3.5 mmol / L Mg2+, 0.2 μmol / L detection probe, 0.04 μmol / L upstream primer, 0.4 μmol / downstream primer. The PCR reaction program was: 3 minutes at 95°C; 50 cycles of 15 seconds at 95°C, 25 seconds at 52°C, and 20 seconds at 72°C; fluorescence signals were collected during the annealing stage at 52°C.

[0037] image 3 It shows that the template amplification curves of the ...

Embodiment 3

[0039] The 12th codon gene mutation of the K-ras gene was selected as the research object. The codon wild type is GGT, and the mutant type is CGT. According to the experimental needs, the gene sequence is synthesized as follows:

[0040] Wild type template:

[0041] TCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAAGTTTATTCAGTCATTTTCAGCAGGCCTTAATAAAAATAATGAAAATGTGACTATATTAGAACATGTCACACATAAGGTTAATACACTATCAAAATACTCCACCAGTACCTTTAATA

[0042] Mutant template:

[0043] TCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACGAGCTCCAACTACCACAAGTTTATATTCAGTCATTTTCAGCAGGCCTTATAATAAAAATAATGAAAATGTGACTATATTAGAACATGTCACACATAAGGTTAATACACTATCAAAATACTCCACCAGTACCTTTAATA

[0044] The primers and probe sequences were designed as follows:

[0045] Upstream primers: GGTGGCGTAG GTATCGTCAAGGCACTCTTGC

[0046] Downstream primer: GGAGTATTTGATAGTGTATTAACCTTATGT

[0047] Detection probe: FAM-CTCCAACTACCACAAAGTTTATATTCAGTC-BHQ

[0048] Homozygous wild-type template 3 was serially diluted 10 times to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high selectivity gene mutation detection method, a high selectivity gene mutation detection primer and a primer design method and relates to gene mutation detection. The high selectivity gene mutation detection method includes designing a corresponding forward primer a reverse primer according to a target gene mutation site and using the forward primer and the reverse primer to perform polymerase chain reaction (PCR) amplification and detect a PCR amplification product so as to find out the target gene mutation site. High selectivity gene mutation detection primers comprise the forward primer and the reverse primer, wherein the forward primer comprises a label sequence, and the label sequence and the position where the mutation site in a forward primer extension sequence of a wild type template is located are reversely complementary. According to the designed high selectivity gene mutation detection primer, the purpose of enriching rare mutation products is achieved by restraining wild type amplification, so that efficient detection of rare mutation is achieved.

Description

technical field [0001] The invention relates to the detection of gene mutations, in particular to a highly selective gene mutation detection method and its primers and primer design method. [0002] Background technique [0003] Gene mutation refers to the sudden and heritable variation of genomic DNA molecules. From the molecular level, gene mutation refers to the change of base pair composition or sequence in gene structure. The study of gene mutation has become one of the hotspots in life science research, and the detection methods have also developed rapidly. There are many methods for genetic testing currently on the market. However, in the context of high wild-type templates, the ability to detect low-level gene mutations is limited, so there are still many challenges in the detection of rare gene mutations. [0004] Rare gene mutations, as the name implies, refer to extremely rare mutant gene sequences in the background of a large number of wild gene sequences. I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
Inventor王小波
OwnerXIAMEN JIKE BIOTECH