Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B

A detection method and clostridial intestinal technology, applied in the field of biomedicine, can solve the problems of missed diagnosis of patients, increased reports of serious infections and outbreaks, inability to distinguish toxigenic strains of Clostridium difficile from non-toxigenic strains, etc. High sex and specificity, reducing the effect of serious infection

Inactive Publication Date: 2013-03-06
ZHANGJIAGANG EENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF5 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Glutamate dehydrogenase (GDH) is an antigenic enzyme protein abundantly expressed on the surface of Clostridium difficile, but immunoenzyme tests cannot distinguish toxin-producing strains of Clostridium difficile from non-toxigenic strains
In addition, the current commercialized immunological C. difficile toxin diagnostic products can only detect toxin A, which leads to the missed diagnosis of many patients caused by clinical A-B+ C. difficile, and makes serious infections and outbreaks caused by A-B+ C. increase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B
  • Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B
  • Dual fluorescence quantitative PCR (polymerase chain reaction) detection method and detection kit for clostridium difficile enterotoxin A and B

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1. Experimental Materials

[0023] 1.1 Bacterial strains and samples to be tested

[0024] The positive nucleic acids of enteric adenovirus 40 / 41, astrovirus and saruvirus (all identified by gene sequencing) were obtained from the Jiangsu Provincial Center for Disease Control and Prevention.

[0025] The samples to be tested came from the stool samples of patients in Jiangsu Province recently, and the samples were collected and transported to the laboratory with ice.

[0026] 1.2 Primers and probes

[0027] Download Clostridium difficile enterotoxin A and B gene sequences from around the world from the NCBI gene bank in the United States, compare their homology, and design specific primers and Taqman fluorescent probes in the conserved gene regions corresponding to the virus genome. The specific sequences as follows:

[0028] Specific primers and probes for the enterotoxin A gene:

[0029] Upstream primer Toxa-FP: TTTTATGCCAGAAGCTCGCT (SEQ ID No: 1)

[0030] Downs...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dual fluorescence quantitative PCR (polymerase chain reaction) detection method and a detection kit for clostridium difficile enterotoxin A and B. The method comprises the steps that 1) the DNA (deoxyribonucleic acid) of a sample to be detected is extracted; 2) the DNA (deoxyribonucleic acid) of the sample to be detected is used as a template and is subjected to fluorescence quantitative PCR reaction; 3) the fluorescence of each cyclic product in the PCR reaction is subjected to fluorescence detection, and whether the sample to be detected contains clostridium difficile enterotoxin A and B or not is judged according to the lowest Ct value and the highest fluorescence value in the fluorescence detection. The invention also discloses a specific primer, a fluorescence probe and the detection kit. The dual fluorescence quantitative PCR detection method is simple, convenient and quick to operate, can detect the clostridium difficile enterotoxin A and B simultaneously, is high in detection sensitivity and specificity and can be applicable to the laboratory emergency detection of outburst epidemic caused by clostridium difficile.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a detection method and a detection kit for Clostridium difficile enterotoxin A and B. Background technique [0002] Clostridium difficile (Clostridium difficile) is a Gram-positive anaerobic bacillus with a spore structure. It is recognized as the most important pathogen of nosocomial infection and antibiotic-associated diarrhea. It can cause pseudomembranous colitis and even lethal by releasing cytotoxin. Clostridium difficile can release a variety of toxins, among which toxins A and B are the main ones, which are the main causes of diarrhea and intestinal inflammation. [0003] Clostridium difficile laboratory diagnosis methods mainly rely on traditional anaerobic culture, cytotoxicity test, bacteria and toxin antigen detection. Among them, bacterial anaerobic culture and cytotoxin neutralization experiments are currently the "gold standard" for laboratory detection of Clostridium d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11C12R1/145
Inventor邵景东王毅谦李辉傅春玲吴福平郭旸
OwnerZHANGJIAGANG EENTRY EXIT INSPECTION & QUARANTINE BUREAU