Epoxide hydrolase enzyme gene and encoding enzymeand and carrier and engineering bacteria and application

A technology of genetically engineered bacteria and epoxides, used in genetic engineering, hydrolase, plant genetic improvement, etc.

Active Publication Date: 2013-03-20
ZHEJIANG UNIV OF TECH
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The biological resolution method has the advantages of mild reaction conditions and environmental friendliness, but there are few reports of active microorganisms that can efficiently resolve racemic epichlorohydrin and phenyloxirane. Therefore, screening for new microorganisms with high selectivity strains, and the epoxide hydrolase gene capable of selectively hydrolyzing racemic epichlorohydrin and phenyloxirane is obtained through genetic engineering technology, and it is of great significance to construct highly expressed genetically engineered bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epoxide hydrolase enzyme gene and encoding enzymeand and carrier and engineering bacteria and application
  • Epoxide hydrolase enzyme gene and encoding enzymeand and carrier and engineering bacteria and application
  • Epoxide hydrolase enzyme gene and encoding enzymeand and carrier and engineering bacteria and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Acquisition of Agromyces sp. ZJB120203

[0046] The present invention takes soil samples from Zhejiang, Jiangsu, Anhui and other places, and takes 40 parts of soil samples altogether. The specific method of screening: Weigh 5 g of soil samples, add 50 mL of sterile water to make soil suspension, take 1.0 mL of supernatant, add it to the screening medium, shake and cultivate at 30 °C and 150 rpm / min for 4 days. Afterwards, the culture solution was taken for gradient dilution, and 10 -4 、10 -5 、10 -6 Gradient dilutions were spread on the solid medium and cultured in a constant temperature incubator at 30°C for 3 days. The grown single colony was picked and inoculated into the liquid fermentation medium for cultivation. Cultured on a shaker at 30°C for 2 days, the cells were collected by centrifugation, and washed with phosphate buffered saline. The cells are used for transformation, and the transformation conditions are as follows: Add cells to phosphate bu...

Embodiment 2

[0083] Example 2: Cloning of the epoxide hydrolase gene

[0084] The total genomic DNA of Agromyces sp. ZJB120203 cells was extracted with a rapid nucleic acid extraction instrument, and the genomic DNA was used as a template for PCR amplification under the action of primer 1 (YKSCAYGGYTGGCCMGG) and primer 2 (SARYGCRGCAAAGTGTCC). The amount of each component in the system (total volume 100 μL): 10×Taq DNA Polymerase Buffer 10 μL (Mg 2+ ), 0.5 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 0.5 μL of each cloning primer 1 and primer 2 at a concentration of 50 μM, 1 μL of genomic DNA, 1 μL of Taq DNA polymerase, and 86.5 μL of nucleic acid-free water.

[0085] Using Biorad’s PCR instrument, the PCR reaction conditions were: pre-denaturation at 94°C for 3 minutes, then entering into a temperature cycle of 94°C for 30 s, 60°C for 30 s, and 72°C for 1.5 min, a total of 30 cycles, and finally extending at 72°C for 10 min, with a termination temperature of 8 ℃....

Embodiment 3

[0087] Embodiment 3: Obtaining of epoxide hydrolase gene

[0088] The total genomic DNA of Soil mold ZJB120203 was extracted with a rapid nucleic acid extractor, and PCR amplification was performed under the action of primer 3 (ATGACCGCGGTGAGTCCCAC) and primer 4 (TCATTGTTCATTTCCTCTCCAATTGG) using the genomic DNA as a template. The amount of each component in the PCR reaction system (total volume 100 μL): 10 μL of 10×Pfu DNA Polymerase Buffer, 0.5 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), cloning primer 3 and primer 4 at a concentration of 50 μM 0.5 μL each, 1 μL of genomic DNA, 1 μL of Pfu DNA Polymerase, and 86.5 μL of nucleic acid-free water.

[0089] Using Biorad’s PCR instrument, the PCR reaction conditions were: pre-denaturation at 94°C for 3 minutes, then entering into a temperature cycle of 94°C for 30 s, 60°C for 30 s, and 72°C for 1.5 min, a total of 30 cycles, and finally extending at 72°C for 10 min, with a termination temperature of 8 ℃...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an epoxide hydrolase enzyme gene, encoding enzymeand, carrier, and recombination gene engineering bacteria which are derived from solid mycete ZJB120203, and application in preparation of recombination epoxide hydrolase. The epoxide hydrolase enzyme gene can be connected with expression carrier and obtain expression recombinant plasmid Pet28a-EH obtaining the epoxide hydrolase enzyme gene, and the expression recombinant plasmid Pet28a-EH converses into escherichia coli BL21 and recombinant escherichia coli is obtained. The recombinant escherichia coli contains recombinant epoxide hydrolase enzyme gene. The recombinant escherichia coli can be used for enzyme resource, and racemic epichlorohydrin and racemic phenyl ethylene oxide are used for substrate, then the bioconversion reaction is carried out and S-epichlorohydrin and R-phenyl ethylene oxide which are with high optical purity are prepared.

Description

(1) Technical field [0001] The invention relates to an epoxide hydrolase gene extracted from Soil mold ZJB120203, encoded enzyme, carrier, engineering bacteria and application. (2) Background technology [0002] Epoxide hydrolases (EC 3.3.2.3) are a group of functionally similar enzymes that stereoselectively catalyze the formation of optically active epoxides and corresponding vicinal diols from epoxides. As a hydrolytic enzyme, it has the characteristics of general hydrolytic enzymes such as: 1. The reaction does not require the assistance of coenzymes. 2. Has a wide range of sources. 3. It still has catalytic activity in non-aqueous solvents. 4. These reactions often display chemical, regio, and stereoenantioselectivity and are capable of working with a broad range of substrates of the same type. [0003] Epoxide hydrolases are ubiquitous in nature and are found in mammals, insects, microorganisms and plants. Mammalian epoxide hydrolase participates in the metabolism ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N9/14C12N15/63C12N1/15C12N1/19C12N1/21C12P41/00C12P17/02
Inventor郑裕国薛锋柳志强邹树平胡忠策沈寅初
OwnerZHEJIANG UNIV OF TECH