Escherichia coli LCT-EC59 under spatial environment and genomic sequence thereof
A technology of LCT-EC59 and Escherichia coli, which is applied in the direction of bacteria, microbe-based methods, microbiological determination/testing, etc., and can solve food poisoning and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Implementation example 1. Escherichia coli LCT-EC59 phenotype in space environment
[0020] 1. Morphology: The original sample was diluted and coated for Gram staining. Escherichia coli LCT-EC59 is a gram-negative bacillus in a space environment, without spores, and the cells are arranged in a single way, such as figure 1 .
[0021] 2. Identification of Escherichia coli LCT-EC59 16s rDNA in space environment: 16S rDNA is the gene of 16S rRNA sequence, about 1.5kb in length. The 16S rDNA was directly amplified by bacterial liquid PCR from the purified single bacteria, and some single bacteria that were difficult to amplify by bacterial liquid PCR were enlarged and cultured, and then the genome was extracted and then amplified. The primer sequences used for amplification were as follows:
[0022] SgF: AGAGTTTGATCATGGCTCAG
[0023] SgR: TAGGGTTACCTTGTTACGACTT
[0024] The 16S rDNA PCR product was purified with a 96-well millpore purification system and quantified accur...
Embodiment 2
[0031] Implementation Example 2, Whole Genome Sequencing of Escherichia coli Space-Mutated Strain LCT-EC59
[0032] The DNA of the sample was paired-end sequenced using high-throughput Solexa sequencing technology. Firstly, the genomic DNA of the bacteria was extracted, and the cells of E. coli LCT-EC52 were collected by centrifugation. After resuspension, lysis, extraction with phenol and chloroform, precipitation with isopropanol, washing with 75% ethanol, removal of RNA by RNase, and dissolution of genomic DNA, the LCT was obtained. - Genomic DNA of EC52, and its purity was tested to make it meet the library construction index. Large fragments of genomic DNA were randomly interrupted by the ultrasonic method Covaris and a series of DNA fragments were generated; then the sticky ends formed by the interruption were repaired into blunt ends with T4DNA Polymerase, Klenow DNA Polymerase and T4PNK, and bases were added through the 3′ end” A", so that the DNA fragment can be conn...
Embodiment 3
[0038] Implementation Example 3. Transcriptome of Escherichia coli LCT-EC59 in Space Environment
[0039] After extracting the total RNA of the sample, use the kit to remove the rRNA and enrich the mRNA with Oligo(dT) magnetic beads. Add fragmentation buffer to break mRNA A into short fragments, use mRNA as a template, use six base random primers (random hexamer s) to synthesize the first cDNA strand, then add buffer, dNTPs, RNaseH and DNA polymeraseI to synthesize the second strand After the cDNA chain is purified by QiaQuickPCR kit and eluted with EB buffer, the end is repaired, polyA is added and the sequencing adapter is connected, and then the size of the fragment is selected by agarose gel electrophoresis, and finally PCR amplification is performed to complete the sequence The library was sequenced using Illumina HiSeq2000. The results showed that 4,421 genes with a gene coverage of 60% accounted for 92% of all genes (such as Figure 5 ). The expression level of the g...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More