Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiple-potency live vaccine for fish and application thereof

An expression vector and blunt technology, which is applied in the field of bacterial vector live vaccines for fish and vaccines, to achieve the effects of easy distinction, low cost and good immune protection effect

Active Publication Date: 2013-04-03
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no effective control measures for this disease in my country.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple-potency live vaccine for fish and application thereof
  • Multiple-potency live vaccine for fish and application thereof
  • Multiple-potency live vaccine for fish and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The construction of embodiment 1 recombinant expression vector

[0058] The recombinant expression vector pUTt-Pdps-ssDmsA-GapA was constructed.

[0059] (1) PCR amplification to obtain the desired gene fragment

[0060] Using the genome of Edwardsiella tarda EIB202 as a template, PCR was performed using the following amplification primers to obtain the Pdps-ssDmsA fusion fragment.

[0061] Pdps-ssDmsA-P1: CCG GAATTC GCCGCATCAGCGCTGAAAAAAAAC, SEQ ID NO: 5

[0062] Pdps-ssDmsA-P2: CTGTTTTTTTTTCATTCTGCATGCTCTCCTTGG, SEQ ID NO: 6

[0063] Pdps-ssDmsA-P3: GGAGAGCATGCAGAATGAAAAAAAACAGTCGG, SEQ ID NO: 7

[0064] Pdps-ssDmsA-P4:CG GGATCC CTTATTCTGCGCGGGCGTAG, SEQ ID NO: 8

[0065] Restriction sites are underlined.

[0066] First, Pdps-ssDmsA-P1, Pdps-ssDmsA-P2, Pdps-ssDmsA-P3 and Pdps-ssDmsA-P4 were used to amplify the upstream and downstream fragments Pdps and ssDmsA required for Overlap PCR respectively. After each fragment was recovered, the Pdps-ssDmsA fusion fra...

Embodiment 2

[0076] Construction and preparation of embodiment 2 recombinant vaccine strain

[0077] (1) Construction of recombinant vaccine strains

[0078] Transform the attenuated strain WED of Edwardsiella tarda with the recombinant vector pUTt-Pdps-ssDmsA-GapA to obtain the recombinant strain, expressed as E.tarda WED::pUTt-Pdps-ssDmsA-GapA, abbreviated as DmsA-GA.

[0079] The attenuated Edwardsiella tarda strain WED was inoculated in 50ml of LB liquid medium, and after overnight shaking culture at 30°C, it was transferred to 50ml of fresh LB liquid medium at a ratio of 1:100 (v / v). Shake culture at 200rpm at ℃ to OD 600 When the concentration is 0.4-0.6, collect the bacteria by centrifugation, place the bacteria in an ice bath for 20 minutes, wash the bacteria three times with 272mM sucrose buffer, and then resuspend the bacteria with sucrose buffer, so that the final concentration of the bacteria is 1 ×10 9 CFU / ml to obtain electroporation competent cells of the attenuated Edwar...

Embodiment 3

[0086] Example 3: Detection of recombinant vaccine strain GapA secretion

[0087] (1) Separation of bacterial protein components

[0088] The recombinant bacterial strain obtained in Example 2 was inoculated in liquid LB medium containing 100 μg / ml ampicillin, cultivated overnight at 200 rpm at 30° C., and inoculated in 50 ml LB liquid medium (containing 100 μg / ml ampicillin). Waiting for OD 600 reach about 0.4, induce with bipyridine (final concentration 200μg / ml), incubate at 200rpm, 30°C for 9h, centrifuge at 5,000g for 10min, and filter the supernatant through a filter membrane with a pore size of 0.22μm. The supernatant was concentrated using a Biomax-10K ultrafiltration membrane (Millipore, USA) to obtain the extracellular protein fraction. Resuspend the bacterial cell pellet in 800 μl of 100 mmol / L Tris-HCl buffer solution with pH 8.6 containing 500 mmol / L sucrose and 0.5 mmol / L EDTA, then add 40 μl of 40 mg / ml lysozyme, mix gently, and then Quickly add 3.2ml Tris-H...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a multiple-potency live vaccine for fish and an application thereof. The vaccine comprises a recombinant expression vector, which is characterized by comprising an Edwardsiella tarda iron inductive promoter dps with encode operability connected, an Edwardsiella tarda Tat signal peptide coding sequence and an aeromonas hydrophila 3-phosphoglyceraldehyde dehydrogenase coding sequence.

Description

technical field [0001] The invention relates to the technical field of vaccines, in particular to the technical field of live bacterial carrier vaccines for fish, and specifically refers to a related preparation and application of a carrier live vaccine against Edwardsiella tarda and Aeromonas hydrophila. Background technique [0002] In view of the continuous growth of the world population and the depletion of natural fishery resources, aquaculture, as a traditional industry, has developed rapidly and effectively in modern times, and has highlighted its important position in society, economy and people's life. According to statistics, in 2002, my country's aquatic products accounted for 71% of the world's total output and 49.8% of the total output value, ranking first in the world. According to FAO statistics, in 2004 the total amount of aquatic products in my country reached 47.5 million tons. However, due to the limitation of water and soil resources, it is difficult to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21A61K39/116A61K39/02A61P31/04C12R1/01
Inventor 王启要王亚敏刘琴吴海珍肖婧凡张元兴
Owner EAST CHINA UNIV OF SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More