One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus

A soybean mosaic virus and isothermal amplification technology, applied in the field of warm amplification detection, can solve the problems of not being used for rapid detection, and achieve the effects of saving redundant time, simplifying the operation process, and speeding up the inspection speed

Inactive Publication Date: 2014-09-24
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This technology has also been gradually applied to the detection of plant viruses, but RT-LAMP detection has not been used for the rapid detection of SMV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus
  • One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus
  • One-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Soybean mosaic virus RT-LAMP primer set design and screening:

[0038] By aligning the SMV coat protein (CP) sequences of different strains in GenBank, find the SMV CP conserved region sequence shown in SEQ ID NO.5 (GenBank: HM590055.1) as the template reference sequence, using online LAMP Primer design software primerExplorer V4 ( http: / / primerexplorerjp / elamp4.0.0 / index.html) Four sets of primer sets were designed, and the primer sets are as follows:

[0039] Primer set I:

[0040] F3-I: GCCATTAGCATCTGGAGAT (SEQ ID NO. 6)

[0041] B3-I: CTTGCTTGAGTACAAACCTAA (SEQ ID NO. 7)

[0042] FIP-I: ACGATGAGCAGATGGGTGTGTACCATTGTCAATGCACCATA (SEQ ID NO. 8)

[0043] BIP-I: TCTTTAACTGCATTGTACCACGCGGTTGATTTATTCAACACTCGA (SEQ ID NO. 9)

[0044] Primer Set II:

[0045] F3: AGATGTAAATGTTGGATC (SEQ ID NO. 1)

[0046] B3: TCATCATCAAGCTCATATT (SEQ ID NO. 2)

[0047] FIP: ATCTTCCCTTCAACCATTGGAAGAAGGTGGTTCCGCGTTTGCAGAAG (SEQ ID NO. 3)

[0048] BIP: CCTAATCAGGTTGATTTATTCA...

Embodiment 2

[0065] Example 2 Optimization experiment of soybean mosaic virus RT-LAMP reaction system

[0066] (1) To optimize the concentration of Mg ions, add 25 mM MgSO in sequence according to the reaction system 4 : 0.8, 1.2, 1.6, 2.0, 2.4, 2.8ul.

[0067] (2) To optimize the betaine concentration, add 5M betaine in sequence according to the reaction system: 0.8, 1.2, 1.6, 2.0, 2.4, 2.8ul.

[0068] (3) To optimize the dNTP concentration, add 10 mM dNTP according to the reaction system: 0.4, 0.6, 0.8, 1.0, 1.2, 1.4ul.

[0069] (4) Optimize the concentration of inner primers (FIP, BIP), and add them in sequence according to the reaction system (FIP, BIP): 0.2, 0.3, 0.4, 0.5, 0.6, 0.7. At this time, the outer primers were all used in 0.2ul.

[0070] The original reaction system (see Example 1) was used for the control group, the control without any RNA was used as the blank control, the plasmid was used as the positive control, and the total RNA extracted from soybean samples with SMV...

Embodiment 3

[0075] Embodiment 3 RT-LAMP and RT-PCR sensitivity comparison

[0076] In order to determine the sensitivity of the two detection methods RT-LAMP and RT-PCR, the concentration of the extracted total RNA was measured with a spectrophotometer, and RNAse-Free ddH was used to measure the concentration of the total RNA. 2 O dilution and stored at -70°C as template. Perform 10 steps on 100ng of RNA template in sequence -1 It was diluted to 0.001ng, 1ul RNA was used as template, and primer set II was used to carry out the reaction according to the system in Example 2. Take 2ul of the amplified product as sample and run it on a 1% agarose gel. At the same time, the same template of RT-LAMP was used, B3 was the reverse transcription primer, and the first strand of cDNA was synthesized by reverse transcription according to the instructions of AMV reverse transcriptase. The cDNA synthesized by RT was used as a template, and F3 and B3 were used as primers for PCR amplification, and a c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus. The primer group is used to carry out RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) reaction; the reaction product is placed to 1% of TBT (Tetrabromoethane) agar gel for electrophoresis or visualization is carried out to the amplification product by using a fluorescent dye SYBR Green I; if the reaction is positive, the soybean mosaic virus exists; if the reaction is negative, the to-be-detected sample does not contain soybean mosaic virus. According to the one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus disclosed by the invention, the RNA (Ribonucleic Acid) quick crude extracting method is combined with the RT-LAMP detection, so that the total RNA nucleic acid of the quickly and crudely extracted to-be-detected sample is used as a reaction template of the RT-LAMP, therefore, the redundancy time for the conventional RNA extracting method of the RT-LAMP is saved, the operation process is simplified, the detection speed is improved, and the one-step detection for the soybean mosaic virus is realized.

Description

technical field [0001] The invention belongs to the field of biological monitoring, and relates to a one-step loop-mediated reverse transcription isothermal amplification detection method for soybean mosaic virus. Background technique [0002] Soybean mosaic virus (SMV) is a virus that is widely distributed and extremely destructive in many countries in the world, and causes huge agricultural economic losses to many countries every year. Because the disease is widely distributed and common in the world, resulting in severe yield reduction and germplasm decline in soybeans, it is very important to develop a rapid detection method for SMV virus disease for the diagnosis of the disease, to accurately grasp the epidemic law of the disease, and to propose effective control measures. important. At present, the detection of soybean mosaic virus disease includes biological identification, electron microscope identification, enzyme-linked immune reaction (ELISA) and reverse transcri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/94
Inventor陶小荣张雯娜卫其巍
OwnerNANJING AGRICULTURAL UNIVERSITY