Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of recombinant trypsin

A trypsin and bovine trypsin technology, applied in the field of genetic engineering, can solve the problems of unknown virus and exogenous factor contamination, application limitation, incomplete separation and purification, etc., and achieve the effect of solving the problem of risk and non-specific cutting

Inactive Publication Date: 2013-07-03
JIANGSU WANBANG BIOPHARMLS +1
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, trypsin is mainly extracted from the pancreas of pigs and cattle. Because of its animal origin, there is a risk of contamination by unknown viruses and exogenous factors, and its application in the pharmaceutical industry is greatly limited; in addition, the pancreas extracted from animal organs Protease, due to incomplete separation and purification, there are some impurities, such as chymotrypsin, which affect its specific cleavage of lysine and arginine sites, and its application in the production and analysis of protein drugs is also greatly restricted

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of recombinant trypsin
  • Preparation method of recombinant trypsin
  • Preparation method of recombinant trypsin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] The preparation of embodiment one recombinant bovine trypsin

[0046] 1. Construction of engineering bacteria

[0047]The cDNA sequence of bovine trypsinogen was artificially synthesized, and McsI / XhoI restriction sites were introduced at both ends. The specific sequence is as follows (see attached figure 1 and Xu List Seq.ID No.1. where 6-710 is coded figure 2 Bovine trypsinogen of (Seq. ID No. 2 and 3).

[0048] TGGCCATGGCGTTCCCGAGTGACGACGATGACAAAATTGTGGGCGGTTACACCTGTGCCGAAAATAGCGTGCCGTATCAAGTTAGCCTGAATGCGGGCTATCATTTTTGCGGCGGTTCACTGATTAACGATCAATGGGTGGTTTCGGCGGCCCATTGTTATCAGTACCACATTCAAGTTCGTCTGGGTGAATATAATATCGATGTCCTGGAAGGCGGTGAACAGTTCATCGACGCCTCAAAAATTATCCGCCACCCGAAATACAGCTCTTGGACCCTGGATAACGACATTCTGCTGATCAAACTGAGCACCCCGGCCGTCATTAATGCACGTGTGTCTACGCTGCTGCTGCCGTCAGCATGCGCTTCGGCAGGTACCGAATGTCTGATCTCCGGCTGGGGTAACACGCTGAGTTCCGGTGTGAATTATCCGGATCTGCTGCAGTGCCTGGTTGCTCCGCTGCTGAGTCATGCTGACTGTGAAGCGTCCTACCCGGGCCAAATTACGAACAATATGATCTGCGCGGGTTTTCTGGAAGGCGGTAAAGATAGCTGCCAGGGTGAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of recombinant trypsin, and relates to the field of genetic engineering. The invention provides an expression vector and an engineering bacterium comprising trypsinogen. According to the method provided by the invention, plasmids with recombinant trypsinogen gene sequence are introduced into Escherichia coli cells, such that recombinant engineering bacteria are constructed; through fermentation, the expression of recombinant trypsinogen is induced; and through renaturation, enterokinase digestion transformation, and separation purification, trypsin with activity is obtained. The method provided by the invention is characterized in that the recombinant trypsin preparation process is simple, and the cost is low.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a preparation method of recombinant trypsin. technical background [0002] Trypsin (Parenzyme) is a serine protease (EC 3.4.21.4). Exist widely as digestive enzymes in invertebrates and vertebrates. The molecular size of trypsin varies from species to species. Bovine trypsin consists of 223 amino acid residues, with a molecular weight of 23300 and an isoelectric point of 10.1-10.5. Trypsin is synthesized in the pancreas as the precursor of the enzyme trypsinogen, secreted through the pancreatic juice, and decomposed into active trypsin by the action of enterokinase in the intestine. It is an endopeptidase that cleaves peptide chains from the carboxyl side of lysine or arginine residues in the peptide chain. Because trypsin is one of the most specific proteases, in the digestive tract, it not only acts as a digestive enzyme, but also decomposes the precursors of o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C12N9/76C12R1/19
Inventor 文良柱温传斌朱亮
Owner JIANGSU WANBANG BIOPHARMLS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More