Preparation method of recombinant trypsin
A trypsin and bovine trypsin technology, applied in the field of genetic engineering, can solve the problems of unknown virus and exogenous factor contamination, application limitation, incomplete separation and purification, etc., and achieve the effect of solving the problem of risk and non-specific cutting
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] The preparation of embodiment one recombinant bovine trypsin
[0046] 1. Construction of engineering bacteria
[0047]The cDNA sequence of bovine trypsinogen was artificially synthesized, and McsI / XhoI restriction sites were introduced at both ends. The specific sequence is as follows (see attached figure 1 and Xu List Seq.ID No.1. where 6-710 is coded figure 2 Bovine trypsinogen of (Seq. ID No. 2 and 3).
[0048] TGGCCATGGCGTTCCCGAGTGACGACGATGACAAAATTGTGGGCGGTTACACCTGTGCCGAAAATAGCGTGCCGTATCAAGTTAGCCTGAATGCGGGCTATCATTTTTGCGGCGGTTCACTGATTAACGATCAATGGGTGGTTTCGGCGGCCCATTGTTATCAGTACCACATTCAAGTTCGTCTGGGTGAATATAATATCGATGTCCTGGAAGGCGGTGAACAGTTCATCGACGCCTCAAAAATTATCCGCCACCCGAAATACAGCTCTTGGACCCTGGATAACGACATTCTGCTGATCAAACTGAGCACCCCGGCCGTCATTAATGCACGTGTGTCTACGCTGCTGCTGCCGTCAGCATGCGCTTCGGCAGGTACCGAATGTCTGATCTCCGGCTGGGGTAACACGCTGAGTTCCGGTGTGAATTATCCGGATCTGCTGCAGTGCCTGGTTGCTCCGCTGCTGAGTCATGCTGACTGTGAAGCGTCCTACCCGGGCCAAATTACGAACAATATGATCTGCGCGGGTTTTCTGGAAGGCGGTAAAGATAGCTGCCAGGGTGAC...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com